Starting /dee2/code/volunteer_pipeline.sh SRR3207792 current disk space = 3057608212480 free memory = 1054779556 SRR3207792 SRAfilesize 54bf592e58ddb235a1289ed8699e8dc0 SRR3207792.sra SRR3207792.sra file validated SRR3207792 is single end SRR3207792 is conventional basespace SRR3207792 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207792_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.6325 40.0 39.0 40.0 35.0 40.0 2 38.18525 40.0 38.0 40.0 35.0 40.0 3 38.4285 40.0 38.0 40.0 35.0 40.0 4 38.4345 40.0 38.0 40.0 35.0 40.0 5 38.38875 40.0 38.0 40.0 35.0 40.0 6 38.456 40.0 38.0 40.0 35.0 40.0 7 38.404 40.0 38.0 40.0 35.0 40.0 8 38.31 40.0 38.0 40.0 35.0 40.0 9 38.35725 40.0 38.0 40.0 35.0 40.0 10 38.24725 40.0 38.0 40.0 35.0 40.0 11 38.34625 40.0 38.0 40.0 35.0 40.0 12 38.25875 40.0 38.0 40.0 35.0 40.0 13 38.28475 40.0 38.0 40.0 35.0 40.0 14 38.15825 40.0 38.0 40.0 35.0 40.0 15 38.18975 40.0 38.0 40.0 35.0 40.0 16 38.179 40.0 38.0 40.0 35.0 40.0 17 38.01125 39.0 38.0 40.0 35.0 40.0 18 38.02 39.0 38.0 40.0 34.0 40.0 19 37.98225 39.0 38.0 40.0 34.0 40.0 20 37.932 39.0 38.0 40.0 34.0 40.0 21 37.87675 39.0 38.0 40.0 34.0 40.0 22 37.82525 39.0 38.0 40.0 35.0 40.0 23 37.85225 39.0 38.0 40.0 34.0 40.0 24 37.64075 39.0 38.0 40.0 33.0 40.0 25 37.571 39.0 38.0 40.0 33.0 40.0 26 37.59 39.0 38.0 40.0 33.0 40.0 27 37.4045 39.0 38.0 40.0 33.0 40.0 28 37.2725 39.0 38.0 40.0 33.0 40.0 29 37.2605 39.0 38.0 40.0 33.0 40.0 30 37.1365 39.0 37.0 40.0 33.0 40.0 31 37.03925 39.0 37.0 40.0 33.0 40.0 32 36.92725 39.0 37.0 40.0 32.0 40.0 33 36.986 39.0 37.0 40.0 33.0 40.0 34 36.88475 39.0 37.0 40.0 32.0 40.0 35 36.93425 39.0 37.0 40.0 32.0 40.0 36 36.795 39.0 37.0 40.0 32.0 40.0 37 36.6625 39.0 36.0 40.0 32.0 40.0 38 36.698 39.0 36.0 40.0 32.0 40.0 39 36.555 39.0 36.0 40.0 31.0 40.0 40 36.31275 39.0 36.0 40.0 30.0 40.0 41 36.40225 39.0 36.0 40.0 32.0 40.0 42 36.26375 39.0 36.0 40.0 31.0 40.0 43 36.202 39.0 36.0 40.0 31.0 40.0 44 36.14625 39.0 36.0 40.0 31.0 40.0 45 35.94175 39.0 36.0 39.0 30.0 40.0 46 36.02125 39.0 36.0 39.0 31.0 40.0 47 35.96925 39.0 36.0 39.0 31.0 40.0 48 35.85725 38.0 36.0 39.0 30.0 40.0 49 35.61125 38.0 35.0 39.0 30.0 40.0 50 35.59025 38.0 35.0 39.0 30.0 40.0 51 35.37375 38.0 35.0 39.0 30.0 40.0 52 35.27525 38.0 35.0 39.0 30.0 40.0 53 35.0845 38.0 35.0 39.0 30.0 40.0 54 34.82875 38.0 35.0 39.0 30.0 40.0 55 34.67825 38.0 35.0 39.0 29.0 40.0 56 34.533 38.0 35.0 39.0 29.0 40.0 57 34.24225 37.0 34.0 39.0 27.0 39.0 58 34.08325 37.0 34.0 39.0 28.0 39.0 59 33.8705 36.0 33.0 39.0 27.0 39.0 60 33.72 36.0 33.0 38.0 27.0 39.0 61 33.48825 36.0 33.0 38.0 27.0 39.0 62 33.3245 36.0 33.0 38.0 26.0 39.0 63 33.0515 36.0 33.0 38.0 25.0 39.0 64 32.90225 36.0 33.0 38.0 25.0 39.0 65 32.544 36.0 33.0 38.0 23.0 39.0 66 32.2855 36.0 33.0 38.0 23.0 39.0 67 32.088 35.0 33.0 38.0 21.0 39.0 68 31.6595 35.0 31.0 38.0 19.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 1.0 6 3.0 7 2.0 8 5.0 9 3.0 10 4.0 11 6.0 12 9.0 13 10.0 14 12.0 15 5.0 16 8.0 17 10.0 18 16.0 19 1.0 20 17.0 21 15.0 22 12.0 23 12.0 24 19.0 25 20.0 26 27.0 27 28.0 28 35.0 29 41.0 30 41.0 31 58.0 32 71.0 33 104.0 34 148.0 35 169.0 36 362.0 37 577.0 38 1154.0 39 992.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.08252063015754 18.35458864716179 11.977994498624655 39.58489622405602 2 16.54458196514271 27.68375852488002 38.82293508461733 16.94872442535994 3 20.849999999999998 27.425 28.825 22.900000000000002 4 23.175 35.05 21.099999999999998 20.674999999999997 5 24.325 36.875 21.275 17.525 6 16.75 37.95 25.674999999999997 19.625 7 15.028757189297323 17.22930732683171 47.23680920230057 20.505126281570394 8 18.5 23.400000000000002 29.4 28.7 9 19.35 23.0 32.625 25.025 10 21.125 39.550000000000004 22.875 16.45 11 24.4 28.025 22.175 25.4 12 19.875 26.05 29.099999999999998 24.975 13 19.25 29.275000000000002 31.075000000000003 20.4 14 20.4 28.849999999999998 29.95 20.8 15 20.25 27.474999999999998 30.025000000000002 22.25 16 21.275 29.075 26.575 23.075000000000003 17 22.125 28.475 28.15 21.25 18 20.599999999999998 28.525 28.075 22.8 19 20.474999999999998 29.849999999999998 28.249999999999996 21.425 20 22.2 28.975 27.200000000000003 21.625 21 20.974999999999998 28.625 27.775 22.625 22 20.724999999999998 29.925 27.224999999999998 22.125 23 21.85 29.5 27.575 21.075 24 21.099999999999998 28.349999999999998 28.9 21.65 25 21.65 28.725 28.075 21.55 26 21.85 29.275000000000002 27.35 21.525 27 21.75543885971493 27.70692673168292 27.556889222305575 22.980745186296573 28 22.255563890972745 29.532383095773945 27.35683920980245 20.855213803450862 29 21.705426356589147 28.75718929732433 28.182045511377847 21.355338834708675 30 21.530382595648913 28.107026756689173 28.68217054263566 21.680420105026258 31 20.8 29.675 27.875 21.65 32 20.9 29.075 28.075 21.95 33 21.25 28.325 28.349999999999998 22.075 34 19.650000000000002 29.25 28.975 22.125 35 21.3 28.499999999999996 29.525000000000002 20.674999999999997 36 22.55 28.799999999999997 27.075 21.575 37 21.175 29.099999999999998 27.325 22.400000000000002 38 20.65 29.925 28.849999999999998 20.575 39 21.175 28.65 27.525 22.650000000000002 40 21.6 28.799999999999997 28.499999999999996 21.099999999999998 41 21.95 28.825 28.1 21.125 42 21.05 29.15 28.875 20.925 43 20.724999999999998 29.225 28.15 21.9 44 20.674999999999997 29.025000000000002 28.925 21.375 45 19.675 29.75 27.500000000000004 23.075000000000003 46 21.3 27.500000000000004 28.325 22.875 47 21.475 29.975 27.125 21.425 48 21.15 27.900000000000002 29.275000000000002 21.675 49 21.25 29.025000000000002 26.700000000000003 23.025000000000002 50 21.3 28.249999999999996 27.85 22.6 51 20.674999999999997 29.849999999999998 28.475 21.0 52 22.2 27.775 28.349999999999998 21.675 53 22.3 29.049999999999997 27.1 21.55 54 20.549999999999997 29.175 28.299999999999997 21.975 55 22.075 27.500000000000004 27.525 22.900000000000002 56 21.725 29.099999999999998 27.1 22.075 57 19.925 28.675 29.2 22.2 58 21.075 29.549999999999997 27.500000000000004 21.875 59 22.45 28.000000000000004 28.825 20.724999999999998 60 21.125 28.925 28.675 21.275 61 22.35 28.175 27.525 21.95 62 21.15 28.475 27.525 22.85 63 21.425 27.125 28.249999999999996 23.200000000000003 64 20.8 29.099999999999998 28.249999999999996 21.85 65 22.900000000000002 28.125 28.075 20.9 66 21.224999999999998 29.45 27.075 22.25 67 22.0 28.4 27.650000000000002 21.95 68 21.025 28.65 28.749999999999996 21.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 5.5 22 9.0 23 10.0 24 11.5 25 12.0 26 20.5 27 29.5 28 30.0 29 41.5 30 63.5 31 74.0 32 85.5 33 98.5 34 100.0 35 132.0 36 182.0 37 200.0 38 224.0 39 276.5 40 308.0 41 311.0 42 346.0 43 363.5 44 346.0 45 343.0 46 308.5 47 277.0 48 277.0 49 236.0 50 195.0 51 178.0 52 134.5 53 108.0 54 97.5 55 75.5 56 64.0 57 51.0 58 30.5 59 23.0 60 19.5 61 11.0 62 6.0 63 6.5 64 8.5 65 6.5 66 3.0 67 3.5 68 2.5 69 1.0 70 1.5 71 1.0 72 0.0 73 1.0 74 1.5 75 1.0 76 0.5 77 0.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.0250000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.025 29 0.025 30 0.025 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84966173891256 99.625 2 0.12528188423953898 0.25 3 0.0 0.0 4 0.0 0.0 5 0.025056376847907794 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTATGCCGTCTTCTGCTTGAAA 5 0.125 TruSeq Adapter, Index 25 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522704 spots for SRR3207792.sra Written 522704 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra Read 522695 spots for SRR3207792.sra Written 522695 spots for SRR3207792.sra SRR ids: ['SRR3207792.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2pj824s0 SRR3207792.sra spots: 10453909 blocks: [[1, 522695], [522696, 1045390], [1045391, 1568085], [1568086, 2090780], [2090781, 2613475], [2613476, 3136170], [3136171, 3658865], [3658866, 4181560], [4181561, 4704255], [4704256, 5226950], [5226951, 5749645], [5749646, 6272340], [6272341, 6795035], [6795036, 7317730], [7317731, 7840425], [7840426, 8363120], [8363121, 8885815], [8885816, 9408510], [9408511, 9931205], [9931206, 10453909]] SRR3207792 file size 2206272 SRR3207792 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207792 SRR3207792_1.fastq Input file: SRR3207792_1.fastq trimmed: SRR3207792-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:46:07 2025 >> started Mon Feb 10 22:46:14 2025 >> done (7.250s) 10453909 reads processed; of these: 12635 ( 0.12%) short reads filtered out after trimming by size control 27386 ( 0.26%) empty reads filtered out after trimming by size control 10413888 (99.62%) reads available; of these: 542281 ( 5.21%) trimmed reads available after processing 9871607 (94.79%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1415 0.01% 19 2329 0.02% 20 4182 0.04% 21 1252 0.01% 22 1577 0.02% 23 2519 0.02% 24 4383 0.04% 25 8095 0.08% 26 2011 0.02% 27 2403 0.02% 28 3502 0.03% 29 5814 0.06% 30 10239 0.10% 31 2471 0.02% 32 3137 0.03% 33 3787 0.04% 34 6149 0.06% 35 10676 0.10% 36 2514 0.02% 37 3274 0.03% 38 4670 0.04% 39 7839 0.08% 40 13724 0.13% 41 3456 0.03% 42 3607 0.03% 43 5164 0.05% 44 8648 0.08% 45 15496 0.15% 46 3643 0.03% 47 4969 0.05% 48 7554 0.07% 49 13501 0.13% 50 24756 0.24% 51 4948 0.05% 52 6447 0.06% 53 10127 0.10% 54 18159 0.17% 55 35737 0.34% 56 6562 0.06% 57 8686 0.08% 58 13678 0.13% 59 25083 0.24% 60 55519 0.53% 61 8327 0.08% 62 11079 0.11% 63 16752 0.16% 64 30523 0.29% 65 59092 0.57% 66 8785 0.08% 67 24021 0.23% 68 9871607 94.79% 10413888 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=113.34 fanout-score-rank=4 prefix-density=0.22 prefix-fanout=17.5 sequence=CTTCTTCTTCCTTTGGGGCTTCGACTGCAACCTCCGTTTCTTCTGCCGGTGCCTCACCAGGCTCTGTAGTCTCTTTAGCCTCCTCGACAACAGGCTCTACGGGTACTTCCGGCTCCTCTTTTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=8 fanout-score=188.42 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=21.1 sequence=TTCTTCTTCTTT Started job on | Feb 10 22:46:29 Started mapping on | Feb 10 22:46:29 Finished on | Feb 10 22:46:38 Mapping speed, Million of reads per hour | 4165.56 Number of input reads | 10413888 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 9878591 Uniquely mapped reads % | 94.86% Average mapped length | 67.06 Number of splices: Total | 1859760 Number of splices: Annotated (sjdb) | 1829611 Number of splices: GT/AG | 1831895 Number of splices: GC/AG | 22558 Number of splices: AT/AC | 2055 Number of splices: Non-canonical | 3252 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 321631 % of reads mapped to multiple loci | 3.09% Number of reads mapped to too many loci | 117579 % of reads mapped to too many loci | 1.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 213666 213666 213666 N_multimapping 321631 321631 321631 N_noFeature 480585 5141587 5150334 N_ambiguous 98940 15310 16495 UnstrandedReadsAssigned:9299066 PositiveStrandReadsAssigned:4721694 NegativeStrandReadsAssigned:4711762 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207792 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207792-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,413,888 reads, 9,624,738 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR3207792.ke.tsv 34699 SRR3207792.se.tsv 87100 total ==> SRR3207792.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 214 17.0606 Potri.005G024800.1.v4.1 1035 936 40 6.53792 Potri.004G059700.1.v4.1 961 862 10 1.7748 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 147.505 7.93477 Potri.016G087400.1.v4.1 270 171 326 291.66 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 26 2.37615 Potri.012G127500.1.v4.1 977 878 1095 190.799 ==> SRR3207792.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1036 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 211 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 28 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207792 completed mapping pipeline successfully