Starting /dee2/code/volunteer_pipeline.sh SRR3207793 current disk space = 3057575444480 free memory = 1474660672 SRR3207793 SRAfilesize 73c77efb143076b90ac054ad4f785432 SRR3207793.sra SRR3207793.sra file validated SRR3207793 is single end SRR3207793 is conventional basespace SRR3207793 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207793_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.5775 40.0 39.0 40.0 35.0 40.0 2 38.06975 40.0 38.0 40.0 35.0 40.0 3 38.372 40.0 38.0 40.0 35.0 40.0 4 38.32525 40.0 38.0 40.0 35.0 40.0 5 38.31725 40.0 38.0 40.0 35.0 40.0 6 38.393 40.0 38.0 40.0 35.0 40.0 7 38.38425 40.0 38.0 40.0 35.0 40.0 8 38.34675 40.0 38.0 40.0 35.0 40.0 9 38.30175 40.0 38.0 40.0 35.0 40.0 10 38.22875 40.0 38.0 40.0 35.0 40.0 11 38.37775 40.0 38.0 40.0 35.0 40.0 12 38.226 40.0 38.0 40.0 35.0 40.0 13 38.25875 40.0 38.0 40.0 35.0 40.0 14 38.18625 40.0 38.0 40.0 35.0 40.0 15 38.09525 39.0 38.0 40.0 35.0 40.0 16 38.0435 40.0 38.0 40.0 35.0 40.0 17 38.00175 39.0 38.0 40.0 34.0 40.0 18 37.92375 39.0 38.0 40.0 34.0 40.0 19 37.89125 39.0 38.0 40.0 33.0 40.0 20 37.846 39.0 38.0 40.0 33.0 40.0 21 37.8965 39.0 38.0 40.0 33.0 40.0 22 37.82375 39.0 38.0 40.0 33.0 40.0 23 37.725 39.0 38.0 40.0 33.0 40.0 24 37.67275 39.0 38.0 40.0 33.0 40.0 25 37.653 39.0 38.0 40.0 33.0 40.0 26 37.56375 39.0 38.0 40.0 33.0 40.0 27 37.45025 39.0 38.0 40.0 33.0 40.0 28 37.339 39.0 38.0 40.0 33.0 40.0 29 37.24175 39.0 37.0 40.0 33.0 40.0 30 37.20175 39.0 37.0 40.0 33.0 40.0 31 37.099 39.0 37.0 40.0 33.0 40.0 32 36.86 39.0 36.0 40.0 32.0 40.0 33 36.96425 39.0 36.0 40.0 32.0 40.0 34 36.907 39.0 36.0 40.0 32.0 40.0 35 36.9725 39.0 36.0 40.0 32.0 40.0 36 36.7705 39.0 36.0 40.0 32.0 40.0 37 36.716 39.0 36.0 40.0 32.0 40.0 38 36.60075 39.0 36.0 40.0 31.0 40.0 39 36.48275 39.0 36.0 40.0 31.0 40.0 40 36.25975 39.0 35.0 40.0 30.0 40.0 41 36.3915 39.0 36.0 40.0 31.0 40.0 42 36.24975 39.0 36.0 40.0 31.0 40.0 43 36.13725 39.0 36.0 40.0 30.0 40.0 44 36.119 39.0 36.0 40.0 31.0 40.0 45 35.798 38.0 35.0 39.0 30.0 40.0 46 35.92975 39.0 36.0 39.0 31.0 40.0 47 35.7625 38.0 36.0 39.0 30.0 40.0 48 35.6615 38.0 35.0 39.0 30.0 40.0 49 35.4775 38.0 35.0 39.0 30.0 40.0 50 35.3475 38.0 35.0 39.0 29.0 40.0 51 35.07375 38.0 35.0 39.0 29.0 40.0 52 35.01875 38.0 35.0 39.0 29.0 40.0 53 34.78625 38.0 35.0 39.0 29.0 40.0 54 34.659 38.0 34.0 39.0 29.0 40.0 55 34.45125 37.0 34.0 39.0 28.0 39.0 56 34.29875 37.0 34.0 39.0 28.0 40.0 57 34.01725 37.0 33.0 39.0 27.0 39.0 58 33.82425 36.0 33.0 39.0 26.0 39.0 59 33.6215 36.0 33.0 39.0 26.0 39.0 60 33.44425 36.0 33.0 38.0 26.0 39.0 61 33.198 36.0 33.0 38.0 25.0 39.0 62 32.981 36.0 33.0 38.0 25.0 39.0 63 32.79725 36.0 33.0 38.0 24.0 39.0 64 32.52075 36.0 33.0 38.0 23.0 39.0 65 32.31275 36.0 33.0 38.0 23.0 39.0 66 32.09725 36.0 33.0 38.0 21.0 39.0 67 31.8245 35.0 32.0 38.0 21.0 39.0 68 31.379 35.0 31.0 38.0 18.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 2.0 8 2.0 9 0.0 10 4.0 11 8.0 12 9.0 13 9.0 14 9.0 15 10.0 16 7.0 17 11.0 18 17.0 19 21.0 20 14.0 21 13.0 22 12.0 23 16.0 24 13.0 25 16.0 26 20.0 27 42.0 28 27.0 29 50.0 30 50.0 31 76.0 32 79.0 33 99.0 34 137.0 35 203.0 36 347.0 37 616.0 38 1121.0 39 937.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.45686421605401 15.003750937734434 13.903475868967242 43.635908977244306 2 20.67830928878765 22.475322703113136 36.876740065806125 19.96962794229309 3 22.275 26.6 27.150000000000002 23.974999999999998 4 24.775 30.85 21.175 23.200000000000003 5 25.45 34.175 21.9 18.475 6 18.175 38.1 22.625 21.099999999999998 7 15.9039759939985 19.379844961240313 43.51087771942986 21.205301325331334 8 18.6 23.150000000000002 30.675 27.575 9 19.725 21.9 32.35 26.025 10 19.625 39.375 23.575 17.424999999999997 11 24.349999999999998 29.349999999999998 22.85 23.45 12 20.525 25.55 29.175 24.75 13 19.275000000000002 28.95 29.625 22.15 14 21.875 28.075 28.249999999999996 21.8 15 21.25 27.224999999999998 28.9 22.625 16 21.45 28.125 28.199999999999996 22.225 17 22.475 27.55 28.325 21.65 18 22.400000000000002 27.950000000000003 27.925 21.725 19 21.85 27.925 28.1 22.125 20 22.650000000000002 27.800000000000004 26.825 22.725 21 20.875 27.85 29.2 22.075 22 21.525 27.3 28.449999999999996 22.725 23 20.349999999999998 27.425 29.099999999999998 23.125 24 21.65 27.825 28.825 21.7 25 21.4 28.799999999999997 27.35 22.45 26 22.075 28.4 28.275 21.25 27 22.255563890972745 28.40710177544386 26.9567391847962 22.380595148787197 28 21.955488872218055 29.15728932233058 26.25656414103526 22.630657664416105 29 22.50562640660165 26.906726681670417 28.35708927231808 22.230557639409852 30 23.15578894723681 26.63165791447862 27.33183295823956 22.88072018004501 31 21.6 28.075 27.775 22.55 32 21.65 28.025 27.725 22.6 33 21.625 27.725 27.450000000000003 23.200000000000003 34 21.575 27.925 26.950000000000003 23.549999999999997 35 21.5 27.500000000000004 28.825 22.175 36 22.0 28.249999999999996 27.125 22.625 37 22.0 27.700000000000003 27.800000000000004 22.5 38 22.3 28.075 27.450000000000003 22.175 39 21.4 28.375 27.500000000000004 22.725 40 21.175 28.275 28.050000000000004 22.5 41 22.875 26.950000000000003 28.475 21.7 42 22.7 26.400000000000002 27.975 22.925 43 21.425 27.6 28.549999999999997 22.425 44 21.725 28.175 26.75 23.35 45 22.650000000000002 28.499999999999996 26.575 22.275 46 21.275 27.750000000000004 27.625 23.35 47 21.675 28.249999999999996 29.2 20.875 48 22.425 28.525 27.0 22.05 49 21.75 26.400000000000002 28.65 23.200000000000003 50 23.525 27.625 26.75 22.1 51 22.625 27.625 27.625 22.125 52 22.6 27.224999999999998 28.4 21.775 53 21.425 28.725 28.000000000000004 21.85 54 22.225 27.775 27.400000000000002 22.6 55 20.7 27.725 29.099999999999998 22.475 56 22.8 27.400000000000002 28.15 21.65 57 22.15 27.900000000000002 28.299999999999997 21.65 58 23.799999999999997 26.5 27.85 21.85 59 21.7 26.974999999999998 28.775000000000002 22.55 60 20.95 29.175 27.3 22.575 61 23.175 27.6 26.825 22.400000000000002 62 21.85 28.9 27.650000000000002 21.6 63 22.325 28.1 27.025 22.55 64 23.400000000000002 27.3 26.625 22.675 65 22.5 29.275000000000002 26.174999999999997 22.05 66 21.525 28.725 27.950000000000003 21.8 67 22.55 28.075 26.525 22.85 68 22.875 28.15 27.725 21.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 3.0 21 4.0 22 2.0 23 3.0 24 5.0 25 6.0 26 8.5 27 15.5 28 20.0 29 22.5 30 33.5 31 42.0 32 50.0 33 70.0 34 82.0 35 97.0 36 140.0 37 168.0 38 184.0 39 256.0 40 324.0 41 336.0 42 340.5 43 363.0 44 381.0 45 379.5 46 356.0 47 334.0 48 321.0 49 257.5 50 207.0 51 189.0 52 155.5 53 140.0 54 129.5 55 96.0 56 73.0 57 63.5 58 42.0 59 30.0 60 26.5 61 19.5 62 16.0 63 14.0 64 8.0 65 5.5 66 7.0 67 5.0 68 2.5 69 2.0 70 3.5 71 3.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.225 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.025 29 0.025 30 0.025 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429520 spots for SRR3207793.sra Written 429520 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra Read 429512 spots for SRR3207793.sra Written 429512 spots for SRR3207793.sra SRR ids: ['SRR3207793.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2hgi4hhm SRR3207793.sra spots: 8590248 blocks: [[1, 429512], [429513, 859024], [859025, 1288536], [1288537, 1718048], [1718049, 2147560], [2147561, 2577072], [2577073, 3006584], [3006585, 3436096], [3436097, 3865608], [3865609, 4295120], [4295121, 4724632], [4724633, 5154144], [5154145, 5583656], [5583657, 6013168], [6013169, 6442680], [6442681, 6872192], [6872193, 7301704], [7301705, 7731216], [7731217, 8160728], [8160729, 8590248]] SRR3207793 file size 1812383 SRR3207793 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207793 SRR3207793_1.fastq Input file: SRR3207793_1.fastq trimmed: SRR3207793-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:57:20 2025 >> started Mon Feb 10 22:57:23 2025 >> done (3.468s) 8590248 reads processed; of these: 10827 ( 0.13%) short reads filtered out after trimming by size control 12089 ( 0.14%) empty reads filtered out after trimming by size control 8567332 (99.73%) reads available; of these: 466455 ( 5.44%) trimmed reads available after processing 8100877 (94.56%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1182 0.01% 19 1916 0.02% 20 3427 0.04% 21 1059 0.01% 22 1428 0.02% 23 2093 0.02% 24 3746 0.04% 25 6743 0.08% 26 1607 0.02% 27 1970 0.02% 28 2941 0.03% 29 4739 0.06% 30 8513 0.10% 31 2077 0.02% 32 2632 0.03% 33 3200 0.04% 34 5202 0.06% 35 8921 0.10% 36 2104 0.02% 37 2807 0.03% 38 4052 0.05% 39 6725 0.08% 40 11837 0.14% 41 2892 0.03% 42 2917 0.03% 43 4234 0.05% 44 7434 0.09% 45 13000 0.15% 46 3099 0.04% 47 4124 0.05% 48 6341 0.07% 49 11558 0.13% 50 21349 0.25% 51 4263 0.05% 52 5652 0.07% 53 8858 0.10% 54 15931 0.19% 55 31419 0.37% 56 5843 0.07% 57 7591 0.09% 58 11540 0.13% 59 22038 0.26% 60 47697 0.56% 61 7302 0.09% 62 9720 0.11% 63 14505 0.17% 64 26371 0.31% 65 51025 0.60% 66 7522 0.09% 67 21309 0.25% 68 8100877 94.56% 8567332 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=36 prefix-density=0.04 prefix-fanout=2.0 sequence=CCAACCTCCTCATAATCCTTCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=199.10 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=20.9 sequence=TTCTTCTTCTTT Started job on | Feb 10 22:57:38 Started mapping on | Feb 10 22:57:38 Finished on | Feb 10 22:57:45 Mapping speed, Million of reads per hour | 4406.06 Number of input reads | 8567332 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 8186786 Uniquely mapped reads % | 95.56% Average mapped length | 67.10 Number of splices: Total | 1668244 Number of splices: Annotated (sjdb) | 1643318 Number of splices: GT/AG | 1644045 Number of splices: GC/AG | 20486 Number of splices: AT/AC | 2012 Number of splices: Non-canonical | 1701 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271394 % of reads mapped to multiple loci | 3.17% Number of reads mapped to too many loci | 85279 % of reads mapped to too many loci | 1.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.26% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 109152 109152 109152 N_multimapping 271394 271394 271394 N_noFeature 285518 4183593 4236254 N_ambiguous 76359 11882 12080 UnstrandedReadsAssigned:7824909 PositiveStrandReadsAssigned:3991311 NegativeStrandReadsAssigned:3938452 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207793 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207793-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,567,332 reads, 8,076,274 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR3207793.ke.tsv 34699 SRR3207793.se.tsv 87100 total ==> SRR3207793.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 248 23.1825 Potri.005G024800.1.v4.1 1035 936 18.0052 3.45068 Potri.004G059700.1.v4.1 961 862 8 1.66481 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 127.514 8.04289 Potri.016G087400.1.v4.1 270 171 308 323.101 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 16.5 1.76812 Potri.012G127500.1.v4.1 977 878 1012 206.761 ==> SRR3207793.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 958 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 151 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207793 completed mapping pipeline successfully