Starting /dee2/code/volunteer_pipeline.sh SRR3207794 current disk space = 3057494933504 free memory = 1574254892 SRR3207794 SRAfilesize e60210e898da66ea655d1a94295b79f9 SRR3207794.sra SRR3207794.sra file validated SRR3207794 is single end SRR3207794 is conventional basespace SRR3207794 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207794_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.58 34.0 31.0 34.0 30.0 34.0 2 31.65075 34.0 31.0 34.0 30.0 34.0 3 31.757 34.0 31.0 34.0 28.0 34.0 4 35.9335 37.0 35.0 37.0 35.0 37.0 5 35.63575 37.0 35.0 37.0 33.0 37.0 6 36.082 37.0 35.0 37.0 35.0 37.0 7 36.017 37.0 35.0 37.0 35.0 37.0 8 36.169 37.0 36.0 37.0 35.0 37.0 9 37.975 39.0 38.0 39.0 35.0 39.0 10-11 37.89475 39.0 38.0 39.0 35.0 39.0 12-13 37.893249999999995 39.0 38.0 39.0 35.0 39.0 14-15 39.289500000000004 41.0 39.0 41.0 36.0 41.0 16-17 39.29625 41.0 39.0 41.0 36.0 41.0 18-19 39.181 40.0 39.0 41.0 36.0 41.0 20-21 38.999625 40.0 38.5 41.0 35.5 41.0 22-23 38.872125 40.0 38.5 41.0 35.0 41.0 24-25 38.75 40.0 38.0 41.0 34.5 41.0 26-27 38.55825 40.0 38.0 41.0 34.0 41.0 28-29 38.304249999999996 40.0 38.0 41.0 34.0 41.0 30-31 37.94625 40.0 38.0 41.0 33.0 41.0 32-33 37.708124999999995 40.0 37.5 41.0 32.0 41.0 34-35 37.638125 40.0 37.5 41.0 32.0 41.0 36-37 37.779375 40.0 38.0 41.0 33.0 41.0 38-39 37.891125 40.0 38.0 41.0 32.5 41.0 40-41 38.023875000000004 40.0 38.0 41.0 33.0 41.0 42-43 37.781875 40.0 38.0 41.0 32.5 41.0 44-45 37.486 40.0 38.0 41.0 32.0 41.0 46-47 37.3375 40.0 37.5 41.0 31.0 41.0 48-49 36.828875 40.0 36.5 41.0 29.5 41.0 50-51 36.819125 40.0 37.0 41.0 30.5 41.0 52-53 36.570375 40.0 36.5 41.0 30.0 41.0 54-55 36.54275 40.0 36.0 41.0 29.5 41.0 56-57 36.188125 39.5 36.0 41.0 28.5 41.0 58-59 35.913125 39.0 35.0 41.0 28.0 41.0 60-61 35.412375 39.0 34.5 40.5 27.0 41.0 62-63 34.975875 38.0 34.0 40.0 26.0 41.0 64-65 34.599125 38.0 34.0 40.0 26.0 41.0 66-67 34.2745 37.5 34.0 40.0 25.5 41.0 68-69 33.75775 37.0 33.5 39.5 23.5 41.0 70-71 33.248374999999996 36.0 33.0 39.0 22.0 41.0 72-73 32.665875 36.0 32.5 39.0 20.5 40.0 74-75 31.99975 35.0 32.0 37.5 18.5 39.5 76-77 30.735875 34.5 30.0 36.0 13.0 39.0 78-79 31.027625 35.0 31.0 36.5 11.5 39.0 80-81 30.5225 35.0 31.0 36.0 6.0 37.5 82-83 29.792125 34.5 29.5 35.5 2.0 37.0 84-85 29.552625 34.0 29.5 35.0 2.0 36.5 86-87 29.256625 34.0 29.5 35.0 2.0 36.0 88-89 28.941875000000003 34.0 29.0 35.0 2.0 36.0 90-91 28.750375 34.0 29.0 35.0 2.0 35.5 92-93 28.2845 34.0 29.0 35.0 2.0 35.0 94-95 28.1115 34.0 29.0 35.0 2.0 35.0 96-97 27.402625 34.0 27.0 35.0 2.0 35.0 98-99 26.711 34.0 25.0 35.0 2.0 35.0 100 26.57475 34.0 25.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 4.0 10 9.0 11 10.0 12 16.0 13 13.0 14 16.0 15 21.0 16 21.0 17 18.0 18 22.0 19 23.0 20 28.0 21 30.0 22 25.0 23 26.0 24 41.0 25 46.0 26 44.0 27 50.0 28 57.0 29 69.0 30 78.0 31 98.0 32 115.0 33 165.0 34 203.0 35 286.0 36 447.0 37 799.0 38 1046.0 39 174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.474979930425473 14.771206850414773 15.94862188921595 43.8051913299438 2 19.05 24.775 37.5 18.675 3 23.175 27.875 27.6 21.349999999999998 4 23.775 33.375 20.75 22.1 5 23.7 36.875 22.175 17.25 6 16.925 40.0 23.775 19.3 7 15.9 17.925 45.225 20.95 8 19.925 23.200000000000003 30.475 26.400000000000002 9 21.725 23.05 30.45 24.775 10-11 22.425 33.9875 22.662499999999998 20.925 12-13 19.925 27.775 29.549999999999997 22.75 14-15 20.45 28.6125 28.762500000000003 22.175 16-17 21.8875 29.037499999999998 27.2625 21.8125 18-19 22.175 28.925 27.2625 21.637500000000003 20-21 21.725 28.575 28.225 21.475 22-23 21.6625 28.925 27.450000000000003 21.9625 24-25 21.3 28.8875 28.199999999999996 21.6125 26-27 21.65 28.212500000000002 27.650000000000002 22.4875 28-29 22.2125 28.6875 27.35 21.75 30-31 21.45 27.6125 27.900000000000002 23.0375 32-33 22.162499999999998 28.275 27.6125 21.95 34-35 21.7 28.825 27.5125 21.9625 36-37 21.337500000000002 28.7375 27.3125 22.6125 38-39 21.987499999999997 29.325000000000003 27.2625 21.425 40-41 21.875 28.3875 27.987499999999997 21.75 42-43 21.762500000000003 27.925 28.125 22.1875 44-45 22.0 28.025 28.0875 21.8875 46-47 22.3125 28.125 28.299999999999997 21.2625 48-49 21.637500000000003 28.1 28.7 21.5625 50-51 21.8875 28.425 28.449999999999996 21.2375 52-53 21.3125 29.225 27.6375 21.825 54-55 22.1 28.475 27.5625 21.8625 56-57 21.955488872218055 28.244561140285075 27.94448612153038 21.85546386596649 58-59 22.125 28.0625 28.1875 21.625 60-61 21.7 28.537499999999998 28.349999999999998 21.4125 62-63 23.0125 28.1125 27.950000000000003 20.925 64-65 22.775000000000002 28.1125 27.025 22.0875 66-67 21.637500000000003 29.275000000000002 27.6125 21.475 68-69 22.75 28.262500000000003 27.8625 21.125 70-71 21.025 27.762500000000003 28.475 22.7375 72-73 21.8875 29.212500000000002 27.4125 21.4875 74-75 22.037499999999998 28.262500000000003 27.825 21.875 76-77 21.279258981099012 28.86468894730254 27.137313806483913 22.71873826511453 78-79 21.65270658832354 28.366045755719465 27.65345668208526 22.327790973871732 80-81 22.025 27.35 28.425 22.2 82-83 21.6 28.8375 27.8125 21.75 84-85 21.55 28.1875 28.7375 21.525 86-87 22.162499999999998 28.6625 28.037499999999998 21.1375 88-89 21.212500000000002 29.099999999999998 28.1125 21.575 90-91 21.6125 28.525 27.900000000000002 21.9625 92-93 22.162499999999998 27.9125 28.1 21.825 94-95 22.075 28.499999999999996 28.925 20.5 96-97 21.912499999999998 28.3375 28.3875 21.3625 98-99 22.775000000000002 29.1125 26.85 21.2625 100 22.775000000000002 27.35 27.625 22.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 2.5 24 2.5 25 1.5 26 4.5 27 7.5 28 7.5 29 10.0 30 18.5 31 33.5 32 43.5 33 55.5 34 68.0 35 82.0 36 105.5 37 125.5 38 138.0 39 171.0 40 204.0 41 222.0 42 239.0 43 273.0 44 286.0 45 264.0 46 258.5 47 250.0 48 224.5 49 179.0 50 151.5 51 125.5 52 96.0 53 75.5 54 60.5 55 49.5 56 37.5 57 30.0 58 19.0 59 14.0 60 11.5 61 9.5 62 7.0 63 6.0 64 7.0 65 5.0 66 2.5 67 2.5 68 2.0 69 1.5 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.025 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.13749999999999998 78-79 0.0125 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645066 spots for SRR3207794.sra Written 1645066 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra Read 1645054 spots for SRR3207794.sra Written 1645054 spots for SRR3207794.sra SRR ids: ['SRR3207794.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6xgc3_xn SRR3207794.sra spots: 32901092 blocks: [[1, 1645054], [1645055, 3290108], [3290109, 4935162], [4935163, 6580216], [6580217, 8225270], [8225271, 9870324], [9870325, 11515378], [11515379, 13160432], [13160433, 14805486], [14805487, 16450540], [16450541, 18095594], [18095595, 19740648], [19740649, 21385702], [21385703, 23030756], [23030757, 24675810], [24675811, 26320864], [26320865, 27965918], [27965919, 29610972], [29610973, 31256026], [31256027, 32901092]] SRR3207794 file size 8551232 SRR3207794 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207794 SRR3207794_1.fastq Input file: SRR3207794_1.fastq trimmed: SRR3207794-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 23:45:15 2025 >> started Mon Feb 10 23:45:32 2025 >> done (16.394s) 32901092 reads processed; of these: 6300 ( 0.02%) short reads filtered out after trimming by size control 5302 ( 0.02%) empty reads filtered out after trimming by size control 32889490 (99.96%) reads available; of these: 4566048 (13.88%) trimmed reads available after processing 28323442 (86.12%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1844 0.01% 19 3009 0.01% 20 5153 0.02% 21 5422 0.02% 22 7766 0.02% 23 11448 0.03% 24 14740 0.04% 25 18856 0.06% 26 18743 0.06% 27 18713 0.06% 28 19192 0.06% 29 19542 0.06% 30 20632 0.06% 31 20990 0.06% 32 21236 0.06% 33 21373 0.06% 34 22398 0.07% 35 22411 0.07% 36 23741 0.07% 37 24134 0.07% 38 25322 0.08% 39 25874 0.08% 40 26593 0.08% 41 28000 0.09% 42 28996 0.09% 43 30144 0.09% 44 30998 0.09% 45 31901 0.10% 46 32211 0.10% 47 33855 0.10% 48 34788 0.11% 49 35476 0.11% 50 35715 0.11% 51 36904 0.11% 52 36926 0.11% 53 38067 0.12% 54 38173 0.12% 55 38099 0.12% 56 39331 0.12% 57 39208 0.12% 58 39264 0.12% 59 40213 0.12% 60 40399 0.12% 61 40197 0.12% 62 40823 0.12% 63 42068 0.13% 64 43205 0.13% 65 44137 0.13% 66 46180 0.14% 67 47073 0.14% 68 48512 0.15% 69 47886 0.15% 70 50228 0.15% 71 50539 0.15% 72 51344 0.16% 73 52682 0.16% 74 53235 0.16% 75 55750 0.17% 76 38372 0.12% 77 42770 0.13% 78 48417 0.15% 79 52647 0.16% 80 55114 0.17% 81 58388 0.18% 82 60711 0.18% 83 63906 0.19% 84 66570 0.20% 85 70731 0.22% 86 73680 0.22% 87 77712 0.24% 88 82287 0.25% 89 90143 0.27% 90 99522 0.30% 91 111070 0.34% 92 123587 0.38% 93 139042 0.42% 94 160544 0.49% 95 190432 0.58% 96 224630 0.68% 97 256417 0.78% 98 274172 0.83% 99 283525 0.86% 100 28323442 86.12% 32889490 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=46.45 fanout-score-rank=11 prefix-density=0.51 prefix-fanout=33.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=9 fanout-score=292.52 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=30.3 sequence=TTCTTCTTCTTT Started job on | Feb 10 23:45:48 Started mapping on | Feb 10 23:45:48 Finished on | Feb 10 23:46:21 Mapping speed, Million of reads per hour | 3587.94 Number of input reads | 32889490 Average input read length | 96 UNIQUE READS: Uniquely mapped reads number | 31717004 Uniquely mapped reads % | 96.44% Average mapped length | 96.47 Number of splices: Total | 9160543 Number of splices: Annotated (sjdb) | 8999105 Number of splices: GT/AG | 9023589 Number of splices: GC/AG | 112985 Number of splices: AT/AC | 9118 Number of splices: Non-canonical | 14851 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 774521 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 232427 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 397965 397965 397965 N_multimapping 774521 774521 774521 N_noFeature 1361835 16316849 16554190 N_ambiguous 310537 51507 51639 UnstrandedReadsAssigned:30044632 PositiveStrandReadsAssigned:15348648 NegativeStrandReadsAssigned:15111175 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207794 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207794-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,889,490 reads, 30,617,587 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR3207794.ke.tsv 34699 SRR3207794.se.tsv 87100 total ==> SRR3207794.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1064 27.1857 Potri.005G024800.1.v4.1 1035 936 119 6.23369 Potri.004G059700.1.v4.1 961 862 55 3.12845 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 558.269 9.62472 Potri.016G087400.1.v4.1 270 171 1357 389.097 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 82 2.40178 Potri.012G127500.1.v4.1 977 878 4015 224.215 ==> SRR3207794.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3635 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 468 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 80 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207794 completed mapping pipeline successfully