Starting /dee2/code/volunteer_pipeline.sh SRR3207795 current disk space = 3057500188672 free memory = 1574591024 SRR3207795 SRAfilesize 21126563fec58f2cd4351245d2042019 SRR3207795.sra SRR3207795.sra file validated SRR3207795 is single end SRR3207795 is conventional basespace SRR3207795 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207795_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.30025 33.0 31.0 34.0 30.0 34.0 2 31.506 34.0 31.0 34.0 27.0 34.0 3 31.6755 34.0 31.0 34.0 28.0 34.0 4 35.919 37.0 35.0 37.0 35.0 37.0 5 35.60225 37.0 35.0 37.0 33.0 37.0 6 36.1025 37.0 35.0 37.0 35.0 37.0 7 36.0975 37.0 35.0 37.0 35.0 37.0 8 36.17575 37.0 36.0 37.0 35.0 37.0 9 37.9665 39.0 38.0 39.0 35.0 39.0 10-11 37.876000000000005 39.0 38.0 39.0 35.0 39.0 12-13 37.806875 39.0 38.0 39.0 35.0 39.0 14-15 39.30575 41.0 39.0 41.0 36.0 41.0 16-17 39.31525 41.0 39.0 41.0 36.0 41.0 18-19 39.178875 40.5 39.0 41.0 35.5 41.0 20-21 39.04375 40.0 38.5 41.0 35.5 41.0 22-23 38.875875 40.0 38.5 41.0 35.0 41.0 24-25 38.705875000000006 40.0 38.0 41.0 34.5 41.0 26-27 38.532125 40.0 38.0 41.0 34.0 41.0 28-29 38.226625 40.0 38.0 41.0 34.0 41.0 30-31 37.873999999999995 40.0 38.0 41.0 33.0 41.0 32-33 37.580749999999995 40.0 37.0 41.0 32.0 41.0 34-35 37.70325 40.0 37.5 41.0 32.5 41.0 36-37 37.834375 40.0 38.0 41.0 33.0 41.0 38-39 37.858875 40.0 38.0 41.0 32.5 41.0 40-41 38.113875 40.0 38.0 41.0 33.5 41.0 42-43 37.9055 40.0 38.0 41.0 33.0 41.0 44-45 37.59025 40.0 38.0 41.0 32.5 41.0 46-47 37.548375 40.0 38.0 41.0 32.5 41.0 48-49 37.017875000000004 40.0 37.0 41.0 30.5 41.0 50-51 36.878 40.0 37.0 41.0 30.5 41.0 52-53 36.73825 40.0 37.0 41.0 30.0 41.0 54-55 36.59525 40.0 36.0 41.0 30.5 41.0 56-57 36.304625 39.5 36.0 41.0 29.0 41.0 58-59 36.08975 39.0 36.0 41.0 28.0 41.0 60-61 35.504374999999996 39.0 34.5 40.5 27.5 41.0 62-63 35.06 38.5 34.5 40.0 26.0 41.0 64-65 34.66075 38.0 34.0 40.0 26.0 41.0 66-67 34.460875 37.5 34.0 40.0 26.0 41.0 68-69 33.949375 37.0 34.0 39.5 25.0 41.0 70-71 33.468375 36.5 33.5 39.0 23.0 41.0 72-73 32.92275 36.0 32.5 39.0 22.5 40.0 74-75 32.125375 35.0 32.0 37.5 20.0 39.0 76-77 30.918125 34.5 30.5 36.0 17.5 39.0 78-79 31.3575 35.0 31.0 36.5 18.5 38.5 80-81 30.822625000000002 35.0 31.0 36.0 10.0 37.0 82-83 29.9875 34.5 30.5 35.5 6.5 37.0 84-85 29.726875 34.0 30.0 35.0 2.0 36.5 86-87 29.475875000000002 34.0 29.5 35.0 2.0 36.0 88-89 29.32125 34.0 30.0 35.0 2.0 36.0 90-91 29.0765 34.0 30.0 35.0 2.0 35.5 92-93 28.60075 34.0 29.0 35.0 2.0 35.0 94-95 28.358125 34.0 29.0 35.0 2.0 35.0 96-97 27.666 33.5 27.5 35.0 2.0 35.0 98-99 26.963 33.5 25.5 35.0 2.0 35.0 100 26.8395 34.0 25.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 6.0 10 11.0 11 5.0 12 10.0 13 14.0 14 10.0 15 16.0 16 22.0 17 24.0 18 21.0 19 26.0 20 28.0 21 16.0 22 38.0 23 27.0 24 37.0 25 35.0 26 32.0 27 49.0 28 63.0 29 56.0 30 83.0 31 86.0 32 139.0 33 168.0 34 189.0 35 288.0 36 449.0 37 856.0 38 1034.0 39 159.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.676025917926566 14.659827213822894 19.41144708423326 41.252699784017274 2 19.175 23.200000000000003 37.3 20.325 3 23.200000000000003 26.174999999999997 27.400000000000002 23.225 4 24.975 33.475 20.325 21.224999999999998 5 24.025 35.675000000000004 22.15 18.15 6 16.925 38.9 24.375 19.8 7 16.45 17.849999999999998 44.95 20.75 8 19.3 23.200000000000003 28.7 28.799999999999997 9 19.8 23.825 31.574999999999996 24.8 10-11 22.650000000000002 34.2375 22.225 20.8875 12-13 19.8125 27.037499999999998 30.075000000000003 23.075000000000003 14-15 21.325 27.325 28.8625 22.4875 16-17 21.75 28.499999999999996 27.0625 22.6875 18-19 21.0625 29.175 27.675 22.0875 20-21 22.4625 28.4375 27.8625 21.2375 22-23 21.3 28.799999999999997 27.650000000000002 22.25 24-25 21.275 28.599999999999998 28.1 22.025 26-27 21.9375 28.050000000000004 28.299999999999997 21.712500000000002 28-29 22.3875 28.025 27.175 22.412499999999998 30-31 21.825 27.8625 28.212500000000002 22.1 32-33 22.7 28.3875 27.1625 21.75 34-35 21.099999999999998 28.8375 27.625 22.4375 36-37 21.4875 28.525 27.6625 22.325 38-39 22.0625 28.425 27.125 22.3875 40-41 22.3125 28.9 26.937499999999996 21.85 42-43 21.3875 28.487499999999997 28.050000000000004 22.075 44-45 22.2625 28.3625 28.349999999999998 21.025 46-47 22.3875 27.8875 27.6 22.125 48-49 21.125 28.487499999999997 28.475 21.912499999999998 50-51 21.717929482370593 29.607401850462615 27.419354838709676 21.255313828457115 52-53 22.14026753344168 28.34104263032879 27.55344418052256 21.965245655706962 54-55 21.9777472184023 27.703462932866607 27.94099262407801 22.377797224653083 56-57 21.61790447611903 28.444611152788195 28.207051762940733 21.73043260815204 58-59 21.9 28.6625 27.8875 21.55 60-61 22.05 28.225 27.9375 21.7875 62-63 21.75 27.55 28.475 22.225 64-65 22.1 27.950000000000003 28.075 21.875 66-67 20.7625 28.3625 28.9 21.975 68-69 21.75 28.275 27.9125 22.0625 70-71 22.768192048012004 27.25681420355089 27.581895473868467 22.393098274568644 72-73 22.211105552776388 27.738869434717362 27.838919459729865 22.211105552776388 74-75 21.780445111277817 27.731932983245812 28.444611152788195 22.043010752688172 76-77 22.293153085492552 28.41406934534986 27.437726874452373 21.85505069470522 78-79 21.435717858929465 29.427213606803406 27.5887943971986 21.548274137068535 80-81 21.023011505752876 28.901950975487743 28.251625812906454 21.823411705852926 82-83 22.05551387846962 27.85696424106027 28.782195548887223 21.305326331582897 84-85 22.761380690345174 27.651325662831418 27.776388194097045 21.810905452726363 86-87 22.405601400350086 28.069517379344838 28.069517379344838 21.45536384096024 88-89 22.45 27.85 27.2625 22.4375 90-91 21.875 28.462500000000002 27.6 22.0625 92-93 21.7875 29.2 27.5625 21.45 94-95 22.0625 27.800000000000004 27.8375 22.3 96-97 21.85 27.925 27.8125 22.412499999999998 98-99 22.28614307153577 27.763881940970485 28.076538269134566 21.87343671835918 100 21.435717858929465 28.564282141070535 27.938969484742373 22.061030515257627 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 2.0 22 2.0 23 1.5 24 2.0 25 6.0 26 6.5 27 5.0 28 9.0 29 12.0 30 16.5 31 23.5 32 29.0 33 49.5 34 69.5 35 83.5 36 94.5 37 109.5 38 145.0 39 180.5 40 209.5 41 236.0 42 246.0 43 261.0 44 272.0 45 246.0 46 240.0 47 234.5 48 227.0 49 208.0 50 147.0 51 125.5 52 118.5 53 90.0 54 67.0 55 50.5 56 40.0 57 29.0 58 19.0 59 15.5 60 13.0 61 10.5 62 9.0 63 6.0 64 3.0 65 1.0 66 0.5 67 2.0 68 2.0 69 1.0 70 3.0 71 4.5 72 3.0 73 0.5 74 1.0 75 1.0 76 0.0 77 0.5 78 0.5 79 1.0 80 1.0 81 0.0 82 0.0 83 1.0 84 1.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.3999999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.025 52-53 0.0125 54-55 0.0125 56-57 0.025 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.025 72-73 0.05 74-75 0.025 76-77 0.13749999999999998 78-79 0.05 80-81 0.05 82-83 0.025 84-85 0.05 86-87 0.025 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.05 100 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730939 spots for SRR3207795.sra Written 1730939 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra Read 1730930 spots for SRR3207795.sra Written 1730930 spots for SRR3207795.sra SRR ids: ['SRR3207795.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wjgykizo SRR3207795.sra spots: 34618609 blocks: [[1, 1730930], [1730931, 3461860], [3461861, 5192790], [5192791, 6923720], [6923721, 8654650], [8654651, 10385580], [10385581, 12116510], [12116511, 13847440], [13847441, 15578370], [15578371, 17309300], [17309301, 19040230], [19040231, 20771160], [20771161, 22502090], [22502091, 24233020], [24233021, 25963950], [25963951, 27694880], [27694881, 29425810], [29425811, 31156740], [31156741, 32887670], [32887671, 34618609]] SRR3207795 file size 8998203 SRR3207795 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207795 SRR3207795_1.fastq Input file: SRR3207795_1.fastq trimmed: SRR3207795-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 23:47:40 2025 >> started Mon Feb 10 23:47:58 2025 >> done (18.083s) 34618609 reads processed; of these: 6841 ( 0.02%) short reads filtered out after trimming by size control 10541 ( 0.03%) empty reads filtered out after trimming by size control 34601227 (99.95%) reads available; of these: 4750271 (13.73%) trimmed reads available after processing 29850956 (86.27%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2140 0.01% 19 3119 0.01% 20 4381 0.01% 21 5758 0.02% 22 8139 0.02% 23 12224 0.04% 24 15716 0.05% 25 19927 0.06% 26 19831 0.06% 27 19985 0.06% 28 20510 0.06% 29 21161 0.06% 30 21934 0.06% 31 22085 0.06% 32 22469 0.06% 33 22862 0.07% 34 23284 0.07% 35 23824 0.07% 36 25327 0.07% 37 25638 0.07% 38 27108 0.08% 39 27149 0.08% 40 27840 0.08% 41 29550 0.09% 42 30459 0.09% 43 31798 0.09% 44 32616 0.09% 45 33986 0.10% 46 34291 0.10% 47 35451 0.10% 48 36333 0.11% 49 37253 0.11% 50 37705 0.11% 51 39071 0.11% 52 38541 0.11% 53 39674 0.11% 54 39930 0.12% 55 39754 0.11% 56 40573 0.12% 57 40851 0.12% 58 40719 0.12% 59 41706 0.12% 60 41836 0.12% 61 41865 0.12% 62 43033 0.12% 63 43787 0.13% 64 44506 0.13% 65 45991 0.13% 66 46938 0.14% 67 48398 0.14% 68 49185 0.14% 69 50190 0.15% 70 52295 0.15% 71 52555 0.15% 72 53757 0.16% 73 55273 0.16% 74 55341 0.16% 75 57822 0.17% 76 39530 0.11% 77 44824 0.13% 78 49992 0.14% 79 54239 0.16% 80 57047 0.16% 81 60404 0.17% 82 63189 0.18% 83 65973 0.19% 84 69412 0.20% 85 73860 0.21% 86 76172 0.22% 87 80117 0.23% 88 86000 0.25% 89 93435 0.27% 90 102111 0.30% 91 114812 0.33% 92 128189 0.37% 93 144776 0.42% 94 167089 0.48% 95 197414 0.57% 96 232158 0.67% 97 266196 0.77% 98 284724 0.82% 99 293164 0.85% 100 29850956 86.27% 34601227 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=9.35 fanout-score-rank=11 prefix-density=0.07 prefix-fanout=9.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=5 fanout-score=191.71 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=24.2 sequence=AAGAAGAAGAAA Started job on | Feb 10 23:48:13 Started mapping on | Feb 10 23:48:14 Finished on | Feb 10 23:48:49 Mapping speed, Million of reads per hour | 3558.98 Number of input reads | 34601227 Average input read length | 96 UNIQUE READS: Uniquely mapped reads number | 33250897 Uniquely mapped reads % | 96.10% Average mapped length | 96.61 Number of splices: Total | 9413804 Number of splices: Annotated (sjdb) | 9251675 Number of splices: GT/AG | 9275936 Number of splices: GC/AG | 113863 Number of splices: AT/AC | 9217 Number of splices: Non-canonical | 14788 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 824513 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 353398 % of reads mapped to too many loci | 1.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 525817 525817 525817 N_multimapping 824513 824513 824513 N_noFeature 1424986 17122587 17328798 N_ambiguous 338743 57171 57458 UnstrandedReadsAssigned:31487168 PositiveStrandReadsAssigned:16071139 NegativeStrandReadsAssigned:15864641 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207795 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207795-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,601,227 reads, 32,212,162 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52401 SRR3207795.ke.tsv 34699 SRR3207795.se.tsv 87100 total ==> SRR3207795.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 977 23.8489 Potri.005G024800.1.v4.1 1035 936 125 6.2558 Potri.004G059700.1.v4.1 961 862 65 3.53228 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 568.964 9.37138 Potri.016G087400.1.v4.1 270 171 1310.53 359.004 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 119.439 3.34226 Potri.012G127500.1.v4.1 977 878 4093 218.371 ==> SRR3207795.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3419 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 469 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 132 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207795 completed mapping pipeline successfully