Starting /dee2/code/volunteer_pipeline.sh SRR3207796 current disk space = 3057487675392 free memory = 1570384908 SRR3207796 SRAfilesize d0a0ec1024abdf028b9b326837c8a7f8 SRR3207796.sra SRR3207796.sra file validated SRR3207796 is single end SRR3207796 is conventional basespace SRR3207796 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207796_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.01475 33.0 31.0 34.0 27.0 34.0 2 31.3415 34.0 31.0 34.0 27.0 34.0 3 31.5175 34.0 31.0 34.0 28.0 34.0 4 35.85625 37.0 35.0 37.0 35.0 37.0 5 35.6065 37.0 35.0 37.0 33.0 37.0 6 36.047 37.0 35.0 37.0 35.0 37.0 7 35.97525 37.0 35.0 37.0 35.0 37.0 8 36.162 37.0 36.0 37.0 35.0 37.0 9 37.9855 39.0 38.0 39.0 35.0 39.0 10-11 37.899625 39.0 38.0 39.0 35.0 39.0 12-13 37.855625 39.0 38.0 39.0 35.0 39.0 14-15 39.270375 41.0 39.0 41.0 36.0 41.0 16-17 39.279875 41.0 39.0 41.0 36.0 41.0 18-19 39.202124999999995 40.5 39.0 41.0 36.0 41.0 20-21 39.05175 40.0 39.0 41.0 35.5 41.0 22-23 38.89575000000001 40.0 38.5 41.0 35.0 41.0 24-25 38.758750000000006 40.0 38.0 41.0 34.0 41.0 26-27 38.540375 40.0 38.0 41.0 34.0 41.0 28-29 38.2365 40.0 38.0 41.0 34.0 41.0 30-31 37.89775 40.0 38.0 41.0 33.0 41.0 32-33 37.72825 40.0 37.5 41.0 32.5 41.0 34-35 37.661625 40.0 37.5 41.0 32.0 41.0 36-37 37.713375 40.0 38.0 41.0 32.5 41.0 38-39 37.72425 40.0 38.0 41.0 32.5 41.0 40-41 37.97725 40.0 38.0 41.0 33.0 41.0 42-43 37.80775 40.0 38.0 41.0 33.0 41.0 44-45 37.464 40.0 38.0 41.0 31.5 41.0 46-47 37.33625 40.0 37.5 41.0 31.0 41.0 48-49 36.70825 40.0 36.5 41.0 29.0 41.0 50-51 36.670875 40.0 37.0 41.0 30.0 41.0 52-53 36.48325 40.0 36.0 41.0 29.0 41.0 54-55 36.405625 40.0 36.0 41.0 29.5 41.0 56-57 36.01575 39.5 35.5 41.0 27.5 41.0 58-59 35.76575 39.0 35.5 41.0 28.0 41.0 60-61 35.044125 38.5 34.5 40.5 26.0 41.0 62-63 34.677 38.0 34.0 40.0 25.0 41.0 64-65 34.15175 38.0 34.0 40.0 22.5 41.0 66-67 33.924 37.5 34.0 40.0 23.0 41.0 68-69 33.61775 37.0 33.5 39.5 22.5 41.0 70-71 33.125125 36.0 33.0 39.0 22.0 41.0 72-73 32.611000000000004 36.0 32.0 39.0 20.5 40.0 74-75 31.785375 35.0 32.0 37.5 13.5 39.5 76-77 30.737625 34.5 30.5 36.0 12.5 39.0 78-79 30.98625 35.0 31.0 36.5 8.5 39.0 80-81 30.532625 35.0 31.0 36.0 4.5 37.5 82-83 29.891624999999998 34.5 30.5 35.5 2.0 37.0 84-85 29.575249999999997 34.0 30.0 35.0 2.0 36.5 86-87 29.176625 34.0 29.0 35.0 2.0 36.0 88-89 28.9435 34.0 29.0 35.0 2.0 36.0 90-91 28.88525 34.0 29.5 35.0 2.0 35.5 92-93 28.43 34.0 29.0 35.0 2.0 35.0 94-95 28.12575 34.0 29.0 35.0 2.0 35.0 96-97 27.32175 33.5 27.0 35.0 2.0 35.0 98-99 26.717750000000002 33.0 25.0 35.0 2.0 35.0 100 26.72975 34.0 26.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 3.0 9 2.0 10 10.0 11 12.0 12 11.0 13 14.0 14 11.0 15 23.0 16 22.0 17 23.0 18 35.0 19 26.0 20 34.0 21 32.0 22 31.0 23 33.0 24 27.0 25 39.0 26 42.0 27 41.0 28 65.0 29 53.0 30 88.0 31 106.0 32 122.0 33 149.0 34 175.0 35 270.0 36 452.0 37 825.0 38 1045.0 39 178.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.599345870809486 15.208503679476696 17.797765058599076 37.394385391114746 2 19.875 24.525 35.35 20.25 3 24.15 27.425 25.85 22.575 4 24.65 33.800000000000004 20.8 20.75 5 24.775 34.5 22.375 18.35 6 17.125 38.5 23.575 20.8 7 17.424999999999997 17.65 43.65 21.275 8 19.6 23.525 30.2 26.674999999999997 9 20.0 22.825 30.875000000000004 26.3 10-11 21.7 34.3125 22.650000000000002 21.337500000000002 12-13 20.849999999999998 26.437500000000004 29.8375 22.875 14-15 20.8 27.5125 28.8875 22.8 16-17 22.5125 28.599999999999998 27.5875 21.3 18-19 20.825 28.449999999999996 28.050000000000004 22.675 20-21 21.575 29.025000000000002 27.5625 21.837500000000002 22-23 21.775 29.65 26.5875 21.987499999999997 24-25 21.7 29.4125 26.6625 22.225 26-27 21.4 29.462500000000002 27.650000000000002 21.4875 28-29 21.837500000000002 28.6875 27.525 21.95 30-31 21.512500000000003 28.625 27.762500000000003 22.1 32-33 21.2 28.375 28.0625 22.3625 34-35 21.85 28.625 27.900000000000002 21.625 36-37 20.775 28.15 28.3875 22.6875 38-39 21.7375 28.3625 28.4 21.5 40-41 21.8125 28.4375 27.2625 22.4875 42-43 21.625 28.1375 27.650000000000002 22.5875 44-45 21.2375 28.6875 27.975 22.1 46-47 22.900000000000002 28.249999999999996 26.775 22.075 48-49 21.6875 28.537499999999998 28.125 21.65 50-51 21.90273784223028 27.853481685210653 27.228403550443808 23.015376922115262 52-53 22.3625 27.6125 27.3125 22.7125 54-55 21.6 27.800000000000004 27.750000000000004 22.85 56-57 21.355338834708675 27.169292323080768 28.51962990747687 22.95573893473368 58-59 21.925 27.425 28.9 21.75 60-61 21.462500000000002 28.037499999999998 27.650000000000002 22.85 62-63 22.0 27.6625 28.6375 21.7 64-65 22.237499999999997 28.4125 27.212500000000002 22.1375 66-67 21.0 27.9125 27.787499999999998 23.3 68-69 20.9125 28.9125 27.6375 22.537499999999998 70-71 21.512500000000003 28.3625 28.375 21.75 72-73 21.45536384096024 27.806951737934483 28.844711177794448 21.892973243310827 74-75 21.427678459807474 27.353419177397175 28.353544193024128 22.86535816977122 76-77 22.220831246870308 27.491236855282924 28.70555833750626 21.58237356034051 78-79 22.083281230461424 27.947980492684753 27.547830436413655 22.420907840440165 80-81 21.345504564211577 27.210203826434913 29.698636988870824 21.745654620482682 82-83 21.602700337542196 27.57844730591324 28.003500437554695 22.815351918989872 84-85 21.765220652581576 27.753469183647955 27.778472309038634 22.702837854731843 86-87 21.915239404925615 27.765970746343292 27.490936367045883 22.82785348168521 88-89 21.4875 28.512500000000003 27.675 22.325 90-91 21.675 27.6375 28.575 22.112499999999997 92-93 22.175 27.55 28.1875 22.0875 94-95 22.1875 27.8875 27.725 22.2 96-97 22.6125 27.700000000000003 27.625 22.0625 98-99 21.61790447611903 27.46936734183546 28.707176794198553 22.20555138784696 100 22.536268134067033 27.763881940970485 27.363681840920464 22.336168084042022 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 2.5 25 4.5 26 5.0 27 6.0 28 8.0 29 11.0 30 18.5 31 23.5 32 28.5 33 44.5 34 64.0 35 83.5 36 98.5 37 107.0 38 136.5 39 182.5 40 199.0 41 211.5 42 249.0 43 278.5 44 280.0 45 268.5 46 265.0 47 238.0 48 222.5 49 200.5 50 149.5 51 121.5 52 106.5 53 92.0 54 67.0 55 51.0 56 36.0 57 25.5 58 20.0 59 15.5 60 11.0 61 6.5 62 8.0 63 8.5 64 6.5 65 3.5 66 5.0 67 3.5 68 0.5 69 3.5 70 5.0 71 1.5 72 1.5 73 2.5 74 1.5 75 0.5 76 1.0 77 1.0 78 1.0 79 2.5 80 1.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0125 52-53 0.0 54-55 0.0 56-57 0.025 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.025 74-75 0.0125 76-77 0.15 78-79 0.0375 80-81 0.0375 82-83 0.0125 84-85 0.0125 86-87 0.0125 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.025 100 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081930 spots for SRR3207796.sra Written 2081930 spots for SRR3207796.sra Read 2081931 spots for SRR3207796.sra Written 2081931 spots for SRR3207796.sra SRR ids: ['SRR3207796.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8zhk75vg SRR3207796.sra spots: 41638601 blocks: [[1, 2081930], [2081931, 4163860], [4163861, 6245790], [6245791, 8327720], [8327721, 10409650], [10409651, 12491580], [12491581, 14573510], [14573511, 16655440], [16655441, 18737370], [18737371, 20819300], [20819301, 22901230], [22901231, 24983160], [24983161, 27065090], [27065091, 29147020], [29147021, 31228950], [31228951, 33310880], [33310881, 35392810], [35392811, 37474740], [37474741, 39556670], [39556671, 41638601]] SRR3207796 file size 10825080 SRR3207796 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207796 SRR3207796_1.fastq Input file: SRR3207796_1.fastq trimmed: SRR3207796-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 23:50:24 2025 >> started Mon Feb 10 23:50:45 2025 >> done (21.196s) 41638601 reads processed; of these: 7484 ( 0.02%) short reads filtered out after trimming by size control 8414 ( 0.02%) empty reads filtered out after trimming by size control 41622703 (99.96%) reads available; of these: 5590573 (13.43%) trimmed reads available after processing 36032130 (86.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2276 0.01% 19 3933 0.01% 20 6578 0.02% 21 6490 0.02% 22 9781 0.02% 23 14259 0.03% 24 18402 0.04% 25 23653 0.06% 26 23068 0.06% 27 23456 0.06% 28 23804 0.06% 29 24440 0.06% 30 25816 0.06% 31 26095 0.06% 32 26312 0.06% 33 26544 0.06% 34 27382 0.07% 35 27862 0.07% 36 29641 0.07% 37 30268 0.07% 38 31567 0.08% 39 31928 0.08% 40 33149 0.08% 41 34320 0.08% 42 35753 0.09% 43 37671 0.09% 44 38518 0.09% 45 39378 0.09% 46 40411 0.10% 47 41424 0.10% 48 43061 0.10% 49 43978 0.11% 50 44136 0.11% 51 45597 0.11% 52 45626 0.11% 53 46633 0.11% 54 46651 0.11% 55 46705 0.11% 56 48186 0.12% 57 48198 0.12% 58 48289 0.12% 59 49007 0.12% 60 49575 0.12% 61 49034 0.12% 62 50312 0.12% 63 51174 0.12% 64 52238 0.13% 65 53785 0.13% 66 55414 0.13% 67 57125 0.14% 68 57962 0.14% 69 59451 0.14% 70 61981 0.15% 71 62060 0.15% 72 62900 0.15% 73 64839 0.16% 74 65625 0.16% 75 68420 0.16% 76 46584 0.11% 77 52828 0.13% 78 58714 0.14% 79 64211 0.15% 80 67023 0.16% 81 71852 0.17% 82 74174 0.18% 83 78239 0.19% 84 81236 0.20% 85 86903 0.21% 86 90133 0.22% 87 94210 0.23% 88 101107 0.24% 89 109895 0.26% 90 120865 0.29% 91 134517 0.32% 92 150966 0.36% 93 170389 0.41% 94 196266 0.47% 95 231184 0.56% 96 274091 0.66% 97 312540 0.75% 98 334124 0.80% 99 346381 0.83% 100 36032130 86.57% 41622703 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=30 prefix-density=0.02 prefix-fanout=3.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=8 fanout-score=195.31 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=23.9 sequence=AAGAAGAAGAAA Started job on | Feb 10 23:51:01 Started mapping on | Feb 10 23:51:01 Finished on | Feb 10 23:51:41 Mapping speed, Million of reads per hour | 3746.04 Number of input reads | 41622703 Average input read length | 96 UNIQUE READS: Uniquely mapped reads number | 40041768 Uniquely mapped reads % | 96.20% Average mapped length | 96.70 Number of splices: Total | 11336716 Number of splices: Annotated (sjdb) | 11141540 Number of splices: GT/AG | 11169774 Number of splices: GC/AG | 138154 Number of splices: AT/AC | 11258 Number of splices: Non-canonical | 17530 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 981233 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 396268 % of reads mapped to too many loci | 0.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 599702 599702 599702 N_multimapping 981233 981233 981233 N_noFeature 1733038 20632581 20872931 N_ambiguous 406150 68341 68989 UnstrandedReadsAssigned:37902580 PositiveStrandReadsAssigned:19340846 NegativeStrandReadsAssigned:19099848 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207796 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207796-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,622,703 reads, 38,747,087 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52401 SRR3207796.ke.tsv 34699 SRR3207796.se.tsv 87100 total ==> SRR3207796.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1118 22.7484 Potri.005G024800.1.v4.1 1035 936 186 7.75928 Potri.004G059700.1.v4.1 961 862 76 3.44263 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 719.858 9.8833 Potri.016G087400.1.v4.1 270 171 1502.54 343.095 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 159.975 3.73148 Potri.012G127500.1.v4.1 977 878 4887 217.336 ==> SRR3207796.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4319 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 589 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 142 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207796 completed mapping pipeline successfully