Starting /dee2/code/volunteer_pipeline.sh SRR3207797 current disk space = 3057410113536 free memory = 1576761256 SRR3207797 SRAfilesize 9576a7a7887eee5bf8e14dd5a31cfcee SRR3207797.sra SRR3207797.sra file validated SRR3207797 is single end SRR3207797 is conventional basespace SRR3207797 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207797_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66625 34.0 33.0 34.0 31.0 34.0 2 33.00175 34.0 34.0 34.0 31.0 34.0 3 33.22925 34.0 34.0 34.0 31.0 34.0 4 36.5015 37.0 37.0 37.0 35.0 37.0 5 36.44225 37.0 37.0 37.0 35.0 37.0 6 36.508 37.0 37.0 37.0 35.0 37.0 7 36.4405 37.0 37.0 37.0 35.0 37.0 8 36.515 37.0 37.0 37.0 35.0 37.0 9 38.3905 39.0 39.0 39.0 37.0 39.0 10-11 38.439750000000004 39.0 39.0 39.0 37.0 39.0 12-13 38.33325 39.0 39.0 39.0 37.0 39.0 14-15 39.890625 41.0 40.0 41.0 38.0 41.0 16-17 39.7715 41.0 40.0 41.0 37.5 41.0 18-19 39.868125 41.0 40.0 41.0 38.0 41.0 20-21 39.815375 41.0 40.0 41.0 37.5 41.0 22-23 39.72775 41.0 40.0 41.0 37.5 41.0 24-25 39.739999999999995 41.0 40.0 41.0 37.0 41.0 26-27 39.652375000000006 41.0 40.0 41.0 37.0 41.0 28-29 39.496875 41.0 39.5 41.0 37.0 41.0 30-31 39.254625000000004 40.5 39.0 41.0 36.5 41.0 32-33 39.255125 41.0 39.0 41.0 36.5 41.0 34-35 39.167 41.0 39.0 41.0 36.0 41.0 36-37 39.112375 41.0 39.0 41.0 35.5 41.0 38-39 39.062125 40.5 39.0 41.0 35.5 41.0 40-41 38.942875 40.5 39.0 41.0 35.0 41.0 42-43 39.1925 41.0 39.0 41.0 36.0 41.0 44-45 39.161874999999995 41.0 39.0 41.0 36.0 41.0 46-47 39.093 41.0 39.0 41.0 36.0 41.0 48-49 38.9805 41.0 39.0 41.0 35.0 41.0 50-51 38.824 41.0 39.0 41.0 35.0 41.0 52-53 38.6755 40.5 39.0 41.0 35.0 41.0 54-55 38.500125 40.0 38.0 41.0 34.0 41.0 56-57 38.33825 40.0 38.0 41.0 34.0 41.0 58-59 38.17375 40.0 38.0 41.0 34.0 41.0 60-61 37.9105 40.0 37.0 41.0 34.0 41.0 62-63 37.671 40.0 37.0 41.0 33.5 41.0 64-65 37.319 39.0 36.0 41.0 33.0 41.0 66-67 36.86275 39.0 36.0 41.0 32.0 41.0 68-69 36.4935 38.5 35.0 40.0 32.0 41.0 70-71 35.9675 37.0 35.0 39.5 31.5 41.0 72-73 35.503 37.0 35.0 39.0 31.0 41.0 74-75 34.96475 36.0 35.0 39.0 30.5 40.0 76-77 33.88525 35.0 33.5 37.0 29.5 39.0 78-79 34.136375 35.0 34.0 37.0 30.0 39.0 80-81 33.852000000000004 35.0 34.0 36.5 30.0 38.5 82-83 33.559875000000005 35.0 34.0 36.0 29.5 37.0 84-85 33.306875 35.0 34.0 36.0 30.0 37.0 86-87 33.127 35.0 34.0 35.0 29.5 36.5 88-89 32.786 35.0 34.0 35.0 29.0 36.0 90-91 32.54474999999999 35.0 34.0 35.0 29.0 36.0 92-93 32.348 35.0 34.0 35.0 28.5 36.0 94-95 32.064375 35.0 33.0 35.0 27.5 35.0 96-97 31.911375 35.0 33.0 35.0 26.5 35.0 98-99 31.792375 35.0 33.0 35.0 26.5 35.0 100 31.59575 35.0 33.0 35.0 26.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 3.0 12 4.0 13 7.0 14 2.0 15 5.0 16 5.0 17 5.0 18 13.0 19 9.0 20 5.0 21 5.0 22 12.0 23 10.0 24 14.0 25 17.0 26 14.0 27 17.0 28 25.0 29 33.0 30 35.0 31 57.0 32 59.0 33 64.0 34 106.0 35 184.0 36 344.0 37 912.0 38 1657.0 39 375.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.10462163534789 15.134586084306756 16.70898933468766 42.0518029456577 2 19.178768152228344 24.56184276414622 36.68002003004507 19.57936905358037 3 22.975 27.025 25.275 24.725 4 24.45 33.175 20.1 22.275 5 23.75 36.199999999999996 22.075 17.974999999999998 6 18.9 39.475 22.75 18.875 7 16.8 17.775 44.45 20.974999999999998 8 19.05 23.025000000000002 30.5 27.425 9 20.375 23.25 32.2 24.175 10-11 22.475 34.362500000000004 22.1875 20.974999999999998 12-13 20.5875 26.35 29.7375 23.325000000000003 14-15 21.4875 26.937499999999996 28.825 22.75 16-17 21.827728466058257 28.116014501812725 28.091011376422053 21.965245655706962 18-19 21.2375 29.299999999999997 27.0875 22.375 20-21 21.925 28.262500000000003 28.037499999999998 21.775 22-23 21.825 28.325 28.125 21.725 24-25 21.1875 28.050000000000004 28.3125 22.45 26-27 21.512500000000003 29.2 27.3125 21.975 28-29 22.525000000000002 27.975 26.9125 22.5875 30-31 20.75 28.475 28.3375 22.4375 32-33 21.987499999999997 27.725 28.15 22.1375 34-35 21.65 28.15 27.6375 22.5625 36-37 21.875 27.6375 27.625 22.8625 38-39 22.075 28.5875 26.924999999999997 22.412499999999998 40-41 21.1875 28.787499999999998 28.3875 21.637500000000003 42-43 20.925 28.549999999999997 28.3625 22.162499999999998 44-45 21.987499999999997 28.1375 27.224999999999998 22.650000000000002 46-47 22.662499999999998 27.400000000000002 27.950000000000003 21.987499999999997 48-49 22.15 27.925 27.375 22.55 50-51 21.275 28.175 28.4 22.15 52-53 22.3625 28.762500000000003 27.762500000000003 21.1125 54-55 21.75 29.349999999999998 27.537499999999998 21.3625 56-57 21.375 29.4125 27.675 21.5375 58-59 22.075 27.450000000000003 28.525 21.95 60-61 21.9 28.499999999999996 27.537499999999998 22.0625 62-63 21.65 28.012500000000003 27.85 22.4875 64-65 22.1875 28.3375 27.450000000000003 22.025 66-67 21.5625 27.900000000000002 28.4375 22.1 68-69 22.05 28.050000000000004 27.537499999999998 22.3625 70-71 21.675 28.512500000000003 27.8125 22.0 72-73 22.662499999999998 28.749999999999996 26.8375 21.75 74-75 21.9625 28.975 27.0 22.0625 76-77 22.45 27.625 28.349999999999998 21.575 78-79 22.162499999999998 27.8625 27.5625 22.412499999999998 80-81 22.662499999999998 27.825 27.5625 21.95 82-83 22.6 29.275000000000002 26.4125 21.712500000000002 84-85 21.3 29.975 27.224999999999998 21.5 86-87 21.7875 28.7375 27.750000000000004 21.725 88-89 22.32087032637239 28.335625859697387 27.935475803426286 21.408028010503937 90-91 21.4125 29.1375 27.200000000000003 22.25 92-93 20.95 29.1875 27.500000000000004 22.3625 94-95 22.35 28.7375 27.200000000000003 21.712500000000002 96-97 22.0625 28.675 27.5125 21.75 98-99 22.0125 28.050000000000004 27.075 22.8625 100 22.425 27.900000000000002 27.35 22.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.0 24 1.5 25 2.0 26 4.5 27 6.5 28 9.5 29 15.0 30 19.0 31 22.5 32 30.0 33 41.0 34 54.5 35 73.5 36 87.0 37 106.0 38 137.5 39 176.0 40 206.0 41 238.5 42 264.0 43 255.0 44 267.5 45 267.5 46 246.0 47 239.5 48 219.0 49 205.0 50 178.0 51 145.0 52 115.0 53 85.5 54 71.5 55 52.5 56 33.0 57 25.0 58 22.5 59 15.5 60 8.0 61 6.5 62 7.5 63 6.0 64 6.0 65 4.5 66 2.5 67 1.0 68 1.0 69 2.0 70 2.0 71 1.0 72 0.5 73 1.0 74 1.5 75 2.0 76 2.0 77 0.5 78 0.0 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0375 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88 0.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141228 spots for SRR3207797.sra Written 1141228 spots for SRR3207797.sra Read 1141239 spots for SRR3207797.sra Written 1141239 spots for SRR3207797.sra SRR ids: ['SRR3207797.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_unv0r9kb SRR3207797.sra spots: 22824571 blocks: [[1, 1141228], [1141229, 2282456], [2282457, 3423684], [3423685, 4564912], [4564913, 5706140], [5706141, 6847368], [6847369, 7988596], [7988597, 9129824], [9129825, 10271052], [10271053, 11412280], [11412281, 12553508], [12553509, 13694736], [13694737, 14835964], [14835965, 15977192], [15977193, 17118420], [17118421, 18259648], [18259649, 19400876], [19400877, 20542104], [20542105, 21683332], [21683333, 22824571]] SRR3207797 file size 5929205 SRR3207797 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207797 SRR3207797_1.fastq Input file: SRR3207797_1.fastq trimmed: SRR3207797-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 00:09:45 2025 >> started Tue Feb 11 00:09:56 2025 >> done (11.387s) 22824571 reads processed; of these: 2745 ( 0.01%) short reads filtered out after trimming by size control 7269 ( 0.03%) empty reads filtered out after trimming by size control 22814557 (99.96%) reads available; of these: 1402463 ( 6.15%) trimmed reads available after processing 21412094 (93.85%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 469 0.00% 19 668 0.00% 20 861 0.00% 21 1117 0.00% 22 1427 0.01% 23 2102 0.01% 24 2608 0.01% 25 3180 0.01% 26 3373 0.01% 27 3299 0.01% 28 3253 0.01% 29 3542 0.02% 30 3595 0.02% 31 3776 0.02% 32 3850 0.02% 33 3744 0.02% 34 4007 0.02% 35 4252 0.02% 36 4300 0.02% 37 4391 0.02% 38 4454 0.02% 39 4487 0.02% 40 4501 0.02% 41 4549 0.02% 42 4805 0.02% 43 5254 0.02% 44 6512 0.03% 45 6418 0.03% 46 6258 0.03% 47 6257 0.03% 48 6785 0.03% 49 6920 0.03% 50 6870 0.03% 51 7221 0.03% 52 7465 0.03% 53 7583 0.03% 54 7725 0.03% 55 7899 0.03% 56 8092 0.04% 57 8278 0.04% 58 8345 0.04% 59 8532 0.04% 60 8714 0.04% 61 8876 0.04% 62 9403 0.04% 63 9356 0.04% 64 9658 0.04% 65 9993 0.04% 66 10634 0.05% 67 10882 0.05% 68 11125 0.05% 69 11335 0.05% 70 11984 0.05% 71 12499 0.05% 72 13172 0.06% 73 13472 0.06% 74 13551 0.06% 75 13795 0.06% 76 9799 0.04% 77 11222 0.05% 78 12986 0.06% 79 13950 0.06% 80 14732 0.06% 81 15723 0.07% 82 16812 0.07% 83 18476 0.08% 84 19174 0.08% 85 21235 0.09% 86 22396 0.10% 87 23469 0.10% 88 25886 0.11% 89 27936 0.12% 90 30654 0.13% 91 34510 0.15% 92 39420 0.17% 93 45744 0.20% 94 54929 0.24% 95 67326 0.30% 96 86599 0.38% 97 111771 0.49% 98 139929 0.61% 99 156312 0.69% 100 21412094 93.85% 22814557 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=59.30 fanout-score-rank=5 prefix-density=0.52 prefix-fanout=37.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=150.31 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=21.4 sequence=AAGAAGAAGAAA Started job on | Feb 11 00:10:14 Started mapping on | Feb 11 00:10:14 Finished on | Feb 11 00:10:33 Mapping speed, Million of reads per hour | 4322.76 Number of input reads | 22814557 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 22046462 Uniquely mapped reads % | 96.63% Average mapped length | 98.66 Number of splices: Total | 6131092 Number of splices: Annotated (sjdb) | 6023340 Number of splices: GT/AG | 6041823 Number of splices: GC/AG | 72961 Number of splices: AT/AC | 5829 Number of splices: Non-canonical | 10479 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 489506 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 170719 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.46% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 278589 278589 278589 N_multimapping 489506 489506 489506 N_noFeature 867217 11356711 11389840 N_ambiguous 240304 35874 37630 UnstrandedReadsAssigned:20938941 PositiveStrandReadsAssigned:10653877 NegativeStrandReadsAssigned:10618992 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207797 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207797-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,814,557 reads, 21,494,023 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52401 SRR3207797.ke.tsv 34699 SRR3207797.se.tsv 87100 total ==> SRR3207797.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 563 19.8275 Potri.005G024800.1.v4.1 1035 936 61 4.40443 Potri.004G059700.1.v4.1 961 862 18 1.41124 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 316.345 7.5174 Potri.016G087400.1.v4.1 270 171 1148 453.713 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 94.5849 3.81858 Potri.012G127500.1.v4.1 977 878 1782 137.167 ==> SRR3207797.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2755 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 453 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 51 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207797 completed mapping pipeline successfully