Starting /dee2/code/volunteer_pipeline.sh SRR3207798 current disk space = 3057699168256 free memory = 1152353092 SRR3207798 SRAfilesize 3f18583a88100b21fc4d2dfc856179de SRR3207798.sra SRR3207798.sra file validated SRR3207798 is single end SRR3207798 is conventional basespace SRR3207798 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207798_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3195 34.0 33.0 34.0 31.0 34.0 2 32.86575 34.0 33.0 34.0 31.0 34.0 3 33.223 34.0 34.0 34.0 31.0 34.0 4 36.5625 37.0 37.0 37.0 35.0 37.0 5 36.43025 37.0 37.0 37.0 35.0 37.0 6 36.514 37.0 37.0 37.0 35.0 37.0 7 36.476 37.0 37.0 37.0 35.0 37.0 8 36.4805 37.0 37.0 37.0 35.0 37.0 9 38.37875 39.0 39.0 39.0 37.0 39.0 10-11 38.42125 39.0 39.0 39.0 37.0 39.0 12-13 38.349625 39.0 39.0 39.0 37.0 39.0 14-15 39.95325 41.0 40.0 41.0 38.0 41.0 16-17 39.8085 41.0 40.0 41.0 38.0 41.0 18-19 39.824124999999995 41.0 40.0 41.0 38.0 41.0 20-21 39.82525 41.0 40.0 41.0 38.0 41.0 22-23 39.725375 41.0 40.0 41.0 37.0 41.0 24-25 39.678 41.0 40.0 41.0 37.0 41.0 26-27 39.5835 41.0 40.0 41.0 37.0 41.0 28-29 39.390625 41.0 39.0 41.0 36.5 41.0 30-31 39.22225 40.5 39.0 41.0 36.5 41.0 32-33 39.272625000000005 41.0 39.0 41.0 36.5 41.0 34-35 39.128875 41.0 39.0 41.0 36.0 41.0 36-37 39.057375 41.0 39.0 41.0 35.5 41.0 38-39 38.9815 40.5 39.0 41.0 36.0 41.0 40-41 38.898125 40.5 38.5 41.0 35.0 41.0 42-43 39.1295 41.0 39.0 41.0 36.0 41.0 44-45 39.12775 41.0 39.0 41.0 35.5 41.0 46-47 39.074 41.0 39.0 41.0 36.0 41.0 48-49 38.975125 41.0 39.0 41.0 35.5 41.0 50-51 38.821625 41.0 39.0 41.0 35.0 41.0 52-53 38.68725 41.0 39.0 41.0 35.0 41.0 54-55 38.52875 40.0 38.0 41.0 35.0 41.0 56-57 38.369125 40.0 38.0 41.0 34.0 41.0 58-59 38.21 40.0 38.0 41.0 34.0 41.0 60-61 37.981750000000005 40.0 37.0 41.0 34.0 41.0 62-63 37.708625 40.0 37.0 41.0 34.0 41.0 64-65 37.32575 39.0 36.0 41.0 33.0 41.0 66-67 36.826125000000005 39.0 35.5 41.0 32.0 41.0 68-69 36.50449999999999 38.5 35.0 40.0 32.0 41.0 70-71 36.002625 37.0 35.0 39.5 31.5 41.0 72-73 35.56425 37.0 35.0 39.0 31.0 41.0 74-75 35.0525 36.0 35.0 39.0 30.5 40.5 76-77 34.011875 35.0 33.5 37.0 29.5 39.0 78-79 34.19925 35.0 34.0 37.0 30.0 39.0 80-81 33.92375 35.0 34.0 36.5 30.0 38.5 82-83 33.626875 35.0 34.0 36.0 30.0 37.0 84-85 33.35875 35.0 34.0 36.0 30.0 37.0 86-87 33.093625 35.0 34.0 35.0 29.5 36.5 88-89 32.75475 35.0 34.0 35.0 29.0 36.0 90-91 32.621625 35.0 34.0 35.0 29.0 36.0 92-93 32.399 35.0 34.0 35.0 29.0 36.0 94-95 32.234125 35.0 34.0 35.0 27.5 35.0 96-97 31.9245 35.0 33.0 35.0 26.0 35.0 98-99 31.822125 35.0 33.0 35.0 27.0 35.0 100 31.58225 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 2.0 11 2.0 12 8.0 13 4.0 14 6.0 15 7.0 16 5.0 17 3.0 18 3.0 19 6.0 20 8.0 21 12.0 22 10.0 23 11.0 24 11.0 25 16.0 26 11.0 27 21.0 28 28.0 29 20.0 30 41.0 31 39.0 32 62.0 33 78.0 34 123.0 35 160.0 36 347.0 37 924.0 38 1679.0 39 351.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.097767513471897 15.088529638183218 18.0651783423146 39.74852450603028 2 18.839129347010257 22.491868901676256 37.378033525143856 21.290968226169625 3 23.175 26.1 26.724999999999998 24.0 4 24.025 32.725 20.775 22.475 5 24.05 34.8 22.975 18.175 6 18.425 37.275000000000006 24.55 19.75 7 16.825000000000003 17.95 44.2 21.025 8 19.425 22.35 30.125 28.1 9 19.975 22.7 31.45 25.874999999999996 10-11 22.725 33.4875 22.225 21.5625 12-13 20.8 26.825 29.175 23.200000000000003 14-15 21.6 28.0625 28.537499999999998 21.8 16-17 21.224999999999998 27.85 28.4375 22.4875 18-19 20.974999999999998 28.0625 28.0875 22.875 20-21 21.8625 28.175 27.575 22.3875 22-23 21.85 27.800000000000004 28.025 22.325 24-25 21.762500000000003 28.3875 27.462500000000002 22.3875 26-27 22.037499999999998 28.025 27.800000000000004 22.1375 28-29 21.825 28.7375 27.962500000000002 21.475 30-31 21.55 27.700000000000003 28.299999999999997 22.45 32-33 21.825 28.299999999999997 27.9375 21.9375 34-35 22.875 28.237499999999997 26.75 22.1375 36-37 22.3875 28.075 27.4125 22.125 38-39 21.5375 28.225 28.1875 22.05 40-41 21.825 28.537499999999998 27.537499999999998 22.1 42-43 21.85 28.6625 28.349999999999998 21.1375 44-45 22.0125 28.925 26.775 22.287499999999998 46-47 21.6875 28.549999999999997 27.450000000000003 22.3125 48-49 21.8 28.012500000000003 28.299999999999997 21.8875 50-51 21.9625 28.15 28.000000000000004 21.8875 52-53 21.425 28.8875 27.625 22.0625 54-55 22.662499999999998 28.125 27.125 22.0875 56-57 21.8625 28.875 26.75 22.5125 58-59 21.75 28.4375 27.474999999999998 22.3375 60-61 21.8625 27.437499999999996 28.212500000000002 22.4875 62-63 22.425 28.1375 27.737499999999997 21.7 64-65 22.7375 28.050000000000004 27.375 21.837500000000002 66-67 21.9 27.787499999999998 28.8625 21.45 68-69 21.875 27.525 27.800000000000004 22.8 70-71 22.125 28.512500000000003 27.375 21.987499999999997 72-73 21.9375 28.875 26.937499999999996 22.25 74-75 21.775 27.9375 27.762500000000003 22.525000000000002 76-77 22.425 28.6375 27.1 21.837500000000002 78-79 21.8125 27.6 28.1625 22.425 80-81 22.3875 27.525 27.4125 22.675 82-83 21.8625 28.512500000000003 27.4125 22.2125 84-85 21.8 27.6 27.8125 22.787499999999998 86-87 21.9 28.4375 27.375 22.287499999999998 88-89 22.0625 28.499999999999996 27.5625 21.875 90-91 22.5 28.1625 28.012500000000003 21.325 92-93 21.6125 27.5125 28.8625 22.0125 94-95 22.35 27.9375 28.6875 21.025 96-97 21.8125 28.237499999999997 27.575 22.375 98-99 22.975 27.6875 27.075 22.2625 100 21.95 28.199999999999996 28.325 21.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 3.0 28 6.5 29 12.5 30 16.5 31 19.5 32 28.0 33 42.5 34 59.0 35 71.0 36 86.0 37 111.5 38 135.0 39 154.5 40 191.5 41 223.5 42 238.5 43 253.0 44 280.5 45 308.5 46 296.0 47 264.5 48 238.5 49 183.5 50 133.5 51 129.5 52 115.0 53 94.5 54 76.5 55 50.5 56 42.0 57 32.0 58 19.0 59 16.0 60 10.5 61 7.0 62 9.0 63 7.5 64 4.5 65 3.5 66 3.5 67 4.0 68 2.0 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131785 spots for SRR3207798.sra Written 2131785 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra Read 2131779 spots for SRR3207798.sra Written 2131779 spots for SRR3207798.sra SRR ids: ['SRR3207798.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8bxz0s_8 SRR3207798.sra spots: 42635586 blocks: [[1, 2131779], [2131780, 4263558], [4263559, 6395337], [6395338, 8527116], [8527117, 10658895], [10658896, 12790674], [12790675, 14922453], [14922454, 17054232], [17054233, 19186011], [19186012, 21317790], [21317791, 23449569], [23449570, 25581348], [25581349, 27713127], [27713128, 29844906], [29844907, 31976685], [31976686, 34108464], [34108465, 36240243], [36240244, 38372022], [38372023, 40503801], [40503802, 42635586]] SRR3207798 file size 11084990 SRR3207798 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207798 SRR3207798_1.fastq Input file: SRR3207798_1.fastq trimmed: SRR3207798-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 23:22:30 2025 >> started Mon Feb 10 23:22:56 2025 >> done (26.033s) 42635586 reads processed; of these: 7255 ( 0.02%) short reads filtered out after trimming by size control 22403 ( 0.05%) empty reads filtered out after trimming by size control 42605928 (99.93%) reads available; of these: 2706859 ( 6.35%) trimmed reads available after processing 39899069 (93.65%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1186 0.00% 19 1380 0.00% 20 3330 0.01% 21 2238 0.01% 22 2951 0.01% 23 4110 0.01% 24 5079 0.01% 25 6493 0.02% 26 6568 0.02% 27 6458 0.02% 28 6436 0.02% 29 6768 0.02% 30 7091 0.02% 31 7126 0.02% 32 7390 0.02% 33 7198 0.02% 34 7775 0.02% 35 8031 0.02% 36 8163 0.02% 37 8582 0.02% 38 8636 0.02% 39 8781 0.02% 40 8631 0.02% 41 8759 0.02% 42 9298 0.02% 43 10244 0.02% 44 12534 0.03% 45 12494 0.03% 46 12202 0.03% 47 12520 0.03% 48 12672 0.03% 49 13002 0.03% 50 13517 0.03% 51 14121 0.03% 52 14753 0.03% 53 14775 0.03% 54 15330 0.04% 55 15668 0.04% 56 15688 0.04% 57 16110 0.04% 58 16095 0.04% 59 16575 0.04% 60 16969 0.04% 61 17251 0.04% 62 18408 0.04% 63 18790 0.04% 64 18591 0.04% 65 19336 0.05% 66 19871 0.05% 67 21246 0.05% 68 21708 0.05% 69 21982 0.05% 70 23019 0.05% 71 24238 0.06% 72 25499 0.06% 73 25891 0.06% 74 26227 0.06% 75 26238 0.06% 76 18854 0.04% 77 21532 0.05% 78 24879 0.06% 79 27100 0.06% 80 28738 0.07% 81 30291 0.07% 82 32825 0.08% 83 36131 0.08% 84 37462 0.09% 85 41211 0.10% 86 43283 0.10% 87 45269 0.11% 88 49778 0.12% 89 54079 0.13% 90 59546 0.14% 91 67587 0.16% 92 76373 0.18% 93 88242 0.21% 94 104969 0.25% 95 130168 0.31% 96 166210 0.39% 97 214871 0.50% 98 267902 0.63% 99 297537 0.70% 100 39899069 93.65% 42605928 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=15.39 fanout-score-rank=5 prefix-density=0.12 prefix-fanout=15.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=69.43 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=12.2 sequence=CCACCACCAACA Started job on | Feb 10 23:23:14 Started mapping on | Feb 10 23:23:15 Finished on | Feb 10 23:23:55 Mapping speed, Million of reads per hour | 3834.53 Number of input reads | 42605928 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 41125538 Uniquely mapped reads % | 96.53% Average mapped length | 98.72 Number of splices: Total | 11909873 Number of splices: Annotated (sjdb) | 11714551 Number of splices: GT/AG | 11739153 Number of splices: GC/AG | 140388 Number of splices: AT/AC | 11466 Number of splices: Non-canonical | 18866 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 906151 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 386764 % of reads mapped to too many loci | 0.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.43% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 574239 574239 574239 N_multimapping 906151 906151 906151 N_noFeature 1501305 21165288 21186446 N_ambiguous 410556 67254 68650 UnstrandedReadsAssigned:39213677 PositiveStrandReadsAssigned:19892996 NegativeStrandReadsAssigned:19870442 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207798 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207798-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,605,928 reads, 40,300,734 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52401 SRR3207798.ke.tsv 34699 SRR3207798.se.tsv 87100 total ==> SRR3207798.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1085 21.2984 Potri.005G024800.1.v4.1 1035 936 84 3.38061 Potri.004G059700.1.v4.1 961 862 27 1.17991 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 640.752 8.48695 Potri.016G087400.1.v4.1 270 171 2145 472.523 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 164 3.69046 Potri.012G127500.1.v4.1 977 878 3048 130.771 ==> SRR3207798.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4857 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 763 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 74 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207798 completed mapping pipeline successfully