Starting /dee2/code/volunteer_pipeline.sh SRR3207799 current disk space = 3057455075328 free memory = 1478840800 SRR3207799 SRAfilesize d93b2b40fedb1d18b342e84e7bcd3be2 SRR3207799.sra SRR3207799.sra file validated SRR3207799 is single end SRR3207799 is conventional basespace SRR3207799 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207799_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.336 34.0 33.0 34.0 31.0 34.0 2 32.81075 34.0 33.0 34.0 31.0 34.0 3 33.18475 34.0 34.0 34.0 31.0 34.0 4 36.55325 37.0 37.0 37.0 35.0 37.0 5 36.446 37.0 37.0 37.0 35.0 37.0 6 36.50675 37.0 37.0 37.0 35.0 37.0 7 36.47875 37.0 37.0 37.0 35.0 37.0 8 36.49325 37.0 37.0 37.0 35.0 37.0 9 38.41775 39.0 39.0 39.0 37.0 39.0 10-11 38.417125 39.0 39.0 39.0 37.0 39.0 12-13 38.3555 39.0 39.0 39.0 37.0 39.0 14-15 39.934375 41.0 40.0 41.0 38.0 41.0 16-17 39.812749999999994 41.0 40.0 41.0 38.0 41.0 18-19 39.792375 41.0 40.0 41.0 37.5 41.0 20-21 39.823750000000004 41.0 40.0 41.0 38.0 41.0 22-23 39.729625 41.0 40.0 41.0 37.0 41.0 24-25 39.669250000000005 41.0 40.0 41.0 37.0 41.0 26-27 39.532 41.0 39.5 41.0 37.0 41.0 28-29 39.41425 41.0 39.0 41.0 37.0 41.0 30-31 39.175625 40.5 39.0 41.0 36.0 41.0 32-33 39.22725 41.0 39.0 41.0 36.5 41.0 34-35 39.162499999999994 41.0 39.0 41.0 36.0 41.0 36-37 39.091875 41.0 39.0 41.0 36.0 41.0 38-39 39.005375 40.0 39.0 41.0 35.5 41.0 40-41 38.918 40.5 38.5 41.0 35.5 41.0 42-43 39.209875 41.0 39.0 41.0 36.0 41.0 44-45 39.113625 41.0 39.0 41.0 35.5 41.0 46-47 39.075375 41.0 39.0 41.0 36.0 41.0 48-49 38.977125 41.0 39.0 41.0 35.0 41.0 50-51 38.84 41.0 39.0 41.0 35.0 41.0 52-53 38.618625 41.0 39.0 41.0 35.0 41.0 54-55 38.46 40.0 38.0 41.0 35.0 41.0 56-57 38.37575 40.0 38.0 41.0 34.5 41.0 58-59 38.127624999999995 40.0 37.5 41.0 34.0 41.0 60-61 37.821875 40.0 37.0 41.0 34.0 41.0 62-63 37.60625 39.5 36.5 41.0 33.0 41.0 64-65 37.296625 39.0 36.0 41.0 33.0 41.0 66-67 36.812749999999994 39.0 35.5 41.0 32.0 41.0 68-69 36.461375000000004 37.5 35.0 40.0 32.0 41.0 70-71 35.93125 37.0 35.0 39.5 31.0 41.0 72-73 35.476124999999996 37.0 35.0 39.0 31.0 41.0 74-75 35.0445 36.0 35.0 39.0 31.0 40.0 76-77 34.011875 35.0 33.5 37.0 29.5 39.0 78-79 34.197125 35.0 34.0 37.0 30.0 39.0 80-81 33.95225 35.0 34.0 37.0 30.5 38.0 82-83 33.65125 35.0 34.0 36.0 30.0 37.0 84-85 33.29425 35.0 34.0 36.0 30.0 37.0 86-87 33.0155 35.0 34.0 35.0 29.0 36.5 88-89 32.728750000000005 35.0 34.0 35.0 29.0 36.0 90-91 32.6035 35.0 34.0 35.0 29.0 36.0 92-93 32.458375000000004 35.0 34.0 35.0 29.0 36.0 94-95 32.213625 35.0 33.5 35.0 28.0 35.0 96-97 31.987625 35.0 33.0 35.0 27.0 35.0 98-99 31.7695 35.0 33.0 35.0 27.0 35.0 100 31.5885 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 3.0 11 4.0 12 3.0 13 4.0 14 2.0 15 3.0 16 7.0 17 8.0 18 7.0 19 9.0 20 7.0 21 11.0 22 12.0 23 11.0 24 9.0 25 13.0 26 19.0 27 21.0 28 19.0 29 19.0 30 27.0 31 59.0 32 51.0 33 83.0 34 106.0 35 189.0 36 332.0 37 964.0 38 1619.0 39 375.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.867590454195536 14.47267128560431 17.346676930972542 40.313061329227615 2 19.779669504256383 23.460190285428144 36.12919379068603 20.630946419629446 3 23.325000000000003 27.0 26.55 23.125 4 24.349999999999998 33.225 19.0 23.425 5 25.0 35.4 21.175 18.425 6 18.725 38.05 23.150000000000002 20.075000000000003 7 16.625 17.175 45.375 20.825 8 18.7 23.200000000000003 28.775000000000002 29.325000000000003 9 20.849999999999998 22.8 29.225 27.125 10-11 22.5125 34.5625 21.5625 21.3625 12-13 20.962500000000002 26.1625 29.562500000000004 23.3125 14-15 20.4125 26.625 29.225 23.7375 16-17 22.765345668208525 27.778472309038634 27.103387923490434 22.352794099262407 18-19 22.225 27.200000000000003 28.0625 22.5125 20-21 22.112499999999997 27.175 28.199999999999996 22.5125 22-23 22.0875 28.6625 26.787499999999998 22.4625 24-25 22.1 27.8125 27.3125 22.775000000000002 26-27 21.9625 27.1625 28.9 21.975 28-29 22.325 28.1 26.787499999999998 22.787499999999998 30-31 21.7875 28.262500000000003 27.6625 22.287499999999998 32-33 21.675 28.012500000000003 28.275 22.037499999999998 34-35 21.025 28.5625 28.212500000000002 22.2 36-37 21.9375 27.987499999999997 27.487499999999997 22.5875 38-39 22.4375 27.875 27.787499999999998 21.9 40-41 21.75 28.4 27.575 22.275 42-43 21.6625 28.6375 27.787499999999998 21.912499999999998 44-45 22.675 27.3375 27.35 22.6375 46-47 22.225 27.787499999999998 27.900000000000002 22.0875 48-49 21.875 28.1875 27.0625 22.875 50-51 21.712500000000002 28.237499999999997 27.6625 22.3875 52-53 22.55 28.599999999999998 27.6875 21.1625 54-55 21.7875 28.625 27.775 21.8125 56-57 20.837500000000002 28.3375 28.3625 22.4625 58-59 22.7375 29.45 26.700000000000003 21.1125 60-61 21.637500000000003 28.599999999999998 26.75 23.0125 62-63 21.25 28.675 28.275 21.8 64-65 23.05 27.5625 27.650000000000002 21.7375 66-67 22.6875 28.199999999999996 27.962500000000002 21.15 68-69 22.6875 27.950000000000003 27.762500000000003 21.6 70-71 22.175 28.812500000000004 26.5 22.5125 72-73 22.3125 27.700000000000003 27.487499999999997 22.5 74-75 22.1875 27.775 28.549999999999997 21.4875 76-77 21.625 28.249999999999996 28.1625 21.9625 78-79 22.425 27.575 27.875 22.125 80-81 21.8 27.6875 28.012500000000003 22.5 82-83 21.975 27.474999999999998 27.5875 22.9625 84-85 21.3875 28.3125 27.3625 22.9375 86-87 22.325 26.9625 28.825 21.8875 88-89 22.62782847855982 27.565945743217902 27.765970746343292 22.040255031878985 90-91 21.4125 27.8875 27.8875 22.8125 92-93 22.037499999999998 27.762500000000003 28.3875 21.8125 94-95 23.6375 27.6875 26.787499999999998 21.8875 96-97 22.7375 28.012500000000003 27.275 21.975 98-99 22.400000000000002 28.625 27.725 21.25 100 21.925 28.625 26.575 22.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 3.0 27 4.5 28 6.0 29 9.5 30 13.5 31 25.0 32 29.0 33 33.0 34 44.0 35 62.0 36 94.0 37 120.5 38 137.5 39 148.0 40 181.0 41 229.5 42 250.5 43 262.5 44 271.0 45 288.5 46 280.0 47 238.5 48 214.0 49 190.5 50 170.5 51 147.5 52 123.0 53 95.0 54 71.5 55 57.5 56 39.5 57 28.5 58 20.0 59 15.5 60 16.0 61 13.5 62 10.5 63 9.5 64 9.0 65 5.5 66 3.0 67 1.5 68 2.5 69 2.5 70 1.0 71 2.0 72 2.0 73 1.5 74 0.5 75 1.5 76 2.0 77 1.5 78 1.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911110 spots for SRR3207799.sra Written 1911110 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra Read 1911100 spots for SRR3207799.sra Written 1911100 spots for SRR3207799.sra SRR ids: ['SRR3207799.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tb_xbdc3 SRR3207799.sra spots: 38222010 blocks: [[1, 1911100], [1911101, 3822200], [3822201, 5733300], [5733301, 7644400], [7644401, 9555500], [9555501, 11466600], [11466601, 13377700], [13377701, 15288800], [15288801, 17199900], [17199901, 19111000], [19111001, 21022100], [21022101, 22933200], [22933201, 24844300], [24844301, 26755400], [26755401, 28666500], [28666501, 30577600], [30577601, 32488700], [32488701, 34399800], [34399801, 36310900], [36310901, 38222010]] SRR3207799 file size 9936354 SRR3207799 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207799 SRR3207799_1.fastq Input file: SRR3207799_1.fastq trimmed: SRR3207799-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 23:47:37 2025 >> started Mon Feb 10 23:48:05 2025 >> done (28.351s) 38222010 reads processed; of these: 5153 ( 0.01%) short reads filtered out after trimming by size control 13691 ( 0.04%) empty reads filtered out after trimming by size control 38203166 (99.95%) reads available; of these: 2435114 ( 6.37%) trimmed reads available after processing 35768052 (93.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1059 0.00% 19 1225 0.00% 20 1665 0.00% 21 2075 0.01% 22 2796 0.01% 23 4063 0.01% 24 4988 0.01% 25 6110 0.02% 26 6132 0.02% 27 6139 0.02% 28 6201 0.02% 29 6479 0.02% 30 6719 0.02% 31 6854 0.02% 32 7078 0.02% 33 6930 0.02% 34 7224 0.02% 35 7600 0.02% 36 7667 0.02% 37 7991 0.02% 38 7937 0.02% 39 8171 0.02% 40 8035 0.02% 41 8164 0.02% 42 8480 0.02% 43 9394 0.02% 44 11433 0.03% 45 11415 0.03% 46 11540 0.03% 47 11418 0.03% 48 11649 0.03% 49 12208 0.03% 50 12395 0.03% 51 12864 0.03% 52 13147 0.03% 53 13520 0.04% 54 13642 0.04% 55 14035 0.04% 56 14125 0.04% 57 14537 0.04% 58 14706 0.04% 59 14834 0.04% 60 15565 0.04% 61 15493 0.04% 62 16304 0.04% 63 16519 0.04% 64 16620 0.04% 65 17153 0.04% 66 18023 0.05% 67 18704 0.05% 68 19764 0.05% 69 19697 0.05% 70 20970 0.05% 71 21658 0.06% 72 23238 0.06% 73 23451 0.06% 74 23994 0.06% 75 24041 0.06% 76 17082 0.04% 77 19541 0.05% 78 22381 0.06% 79 23941 0.06% 80 25668 0.07% 81 27128 0.07% 82 29131 0.08% 83 32204 0.08% 84 33533 0.09% 85 36474 0.10% 86 39070 0.10% 87 40593 0.11% 88 44339 0.12% 89 48189 0.13% 90 52639 0.14% 91 60448 0.16% 92 67933 0.18% 93 78468 0.21% 94 94610 0.25% 95 116132 0.30% 96 147751 0.39% 97 192197 0.50% 98 241742 0.63% 99 268082 0.70% 100 35768052 93.63% 38203166 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=38 prefix-density=0.06 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=144.65 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=20.8 sequence=AAGAAGAAGAAA Started job on | Feb 10 23:48:21 Started mapping on | Feb 10 23:48:21 Finished on | Feb 10 23:48:56 Mapping speed, Million of reads per hour | 3929.47 Number of input reads | 38203166 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 36701426 Uniquely mapped reads % | 96.07% Average mapped length | 98.74 Number of splices: Total | 10362208 Number of splices: Annotated (sjdb) | 10190293 Number of splices: GT/AG | 10213491 Number of splices: GC/AG | 121597 Number of splices: AT/AC | 10154 Number of splices: Non-canonical | 16966 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.97 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 854054 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 467358 % of reads mapped to too many loci | 1.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 647686 647686 647686 N_multimapping 854054 854054 854054 N_noFeature 1382299 18917065 18899080 N_ambiguous 387059 59007 60882 UnstrandedReadsAssigned:34932068 PositiveStrandReadsAssigned:17725354 NegativeStrandReadsAssigned:17741464 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207799 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207799-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,203,166 reads, 36,053,874 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR3207799.ke.tsv 34699 SRR3207799.se.tsv 87100 total ==> SRR3207799.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 976 20.8245 Potri.005G024800.1.v4.1 1035 936 55 2.40595 Potri.004G059700.1.v4.1 961 862 24 1.14 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 485.639 6.99171 Potri.016G087400.1.v4.1 270 171 1721 412.083 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 136 3.32646 Potri.012G127500.1.v4.1 977 878 3663 170.821 ==> SRR3207799.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4305 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 700 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 81 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR3207799 completed mapping pipeline successfully