Starting /dee2/code/volunteer_pipeline.sh SRR3207800 current disk space = 3057429159936 free memory = 1508476504 SRR3207800 SRAfilesize 23aeef2195eb58c95ddcf44ec56a0f42 SRR3207800.sra SRR3207800.sra file validated SRR3207800 is single end SRR3207800 is conventional basespace SRR3207800 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207800_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.53875 34.0 33.0 34.0 31.0 34.0 2 32.93975 34.0 33.0 34.0 31.0 34.0 3 33.24325 34.0 34.0 34.0 31.0 34.0 4 36.58625 37.0 37.0 37.0 35.0 37.0 5 36.497 37.0 37.0 37.0 35.0 37.0 6 36.5035 37.0 37.0 37.0 35.0 37.0 7 36.45275 37.0 37.0 37.0 35.0 37.0 8 36.49575 37.0 37.0 37.0 35.0 37.0 9 38.4135 39.0 39.0 39.0 37.0 39.0 10-11 38.413 39.0 39.0 39.0 37.0 39.0 12-13 38.3495 39.0 39.0 39.0 37.0 39.0 14-15 39.92375 41.0 40.0 41.0 38.0 41.0 16-17 39.8155 41.0 40.0 41.0 38.0 41.0 18-19 39.87675 41.0 40.0 41.0 38.0 41.0 20-21 39.838875 41.0 40.0 41.0 38.0 41.0 22-23 39.741625 41.0 40.0 41.0 37.5 41.0 24-25 39.683625 41.0 40.0 41.0 37.0 41.0 26-27 39.58125 41.0 40.0 41.0 37.0 41.0 28-29 39.487 41.0 39.0 41.0 37.0 41.0 30-31 39.288624999999996 41.0 39.0 41.0 36.5 41.0 32-33 39.274375000000006 41.0 39.0 41.0 36.0 41.0 34-35 39.236 41.0 39.0 41.0 36.5 41.0 36-37 39.165 41.0 39.0 41.0 36.0 41.0 38-39 39.024 40.0 39.0 41.0 35.0 41.0 40-41 38.9625 40.5 39.0 41.0 35.5 41.0 42-43 39.286625 41.0 39.0 41.0 36.5 41.0 44-45 39.219125000000005 41.0 39.0 41.0 36.0 41.0 46-47 39.099625 41.0 39.0 41.0 36.0 41.0 48-49 39.06075 41.0 39.0 41.0 35.5 41.0 50-51 38.923500000000004 41.0 39.0 41.0 35.0 41.0 52-53 38.7405 41.0 39.0 41.0 35.0 41.0 54-55 38.511250000000004 40.0 38.0 41.0 34.5 41.0 56-57 38.34625 40.0 38.0 41.0 34.0 41.0 58-59 38.1725 40.0 38.0 41.0 34.0 41.0 60-61 37.9005 40.0 37.0 41.0 33.5 41.0 62-63 37.67875 39.5 37.0 41.0 33.5 41.0 64-65 37.33925 39.0 36.0 41.0 33.0 41.0 66-67 36.9025 39.0 36.0 41.0 32.5 41.0 68-69 36.642375 38.5 35.0 40.0 32.0 41.0 70-71 36.04575 37.0 35.0 39.5 31.0 41.0 72-73 35.630875 37.0 35.0 39.0 31.0 41.0 74-75 35.158249999999995 36.0 35.0 39.0 31.0 40.0 76-77 34.098 35.0 33.5 37.0 29.5 39.0 78-79 34.229124999999996 35.0 34.0 37.0 30.0 39.0 80-81 33.981750000000005 35.0 34.0 36.5 30.0 38.5 82-83 33.621875 35.0 34.0 36.0 29.5 37.0 84-85 33.36775 35.0 34.0 36.0 30.0 37.0 86-87 33.151624999999996 35.0 34.0 35.5 29.0 36.5 88-89 32.87525 35.0 34.0 35.0 29.0 36.0 90-91 32.66225 35.0 34.0 35.0 29.0 36.0 92-93 32.400125 35.0 34.0 35.0 29.0 36.0 94-95 32.168875 35.0 33.5 35.0 27.5 35.0 96-97 31.904625 35.0 33.0 35.0 27.0 35.0 98-99 31.798125 35.0 33.0 35.0 27.0 35.0 100 31.66725 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 2.0 8 1.0 9 1.0 10 1.0 11 0.0 12 4.0 13 5.0 14 4.0 15 6.0 16 5.0 17 6.0 18 5.0 19 8.0 20 8.0 21 8.0 22 5.0 23 9.0 24 8.0 25 12.0 26 15.0 27 20.0 28 20.0 29 33.0 30 38.0 31 44.0 32 66.0 33 88.0 34 111.0 35 170.0 36 334.0 37 960.0 38 1625.0 39 377.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.955391282182006 14.682640836094826 17.86897782309457 42.4929900586286 2 19.383921863260706 23.59128474830954 37.08990733784122 19.93488605058853 3 22.625 26.400000000000002 27.525 23.45 4 24.625 31.25 19.525000000000002 24.6 5 24.025 35.5 22.55 17.925 6 18.075 38.45 24.9 18.575 7 17.0 18.5 44.275 20.225 8 19.5 23.400000000000002 29.925 27.175 9 20.375 22.925 31.2 25.5 10-11 22.05 33.800000000000004 22.537499999999998 21.6125 12-13 20.1625 26.6125 30.4625 22.7625 14-15 20.925 27.675 29.5375 21.8625 16-17 21.1375 28.175 27.962500000000002 22.725 18-19 22.6375 28.000000000000004 28.000000000000004 21.3625 20-21 21.575 27.6625 28.3875 22.375 22-23 21.4125 28.799999999999997 28.237499999999997 21.55 24-25 22.25 28.225 27.825 21.7 26-27 20.974999999999998 29.4375 27.450000000000003 22.1375 28-29 21.75 28.825 27.737499999999997 21.6875 30-31 21.45 27.962500000000002 27.975 22.6125 32-33 21.8 28.6625 27.762500000000003 21.775 34-35 20.7125 28.799999999999997 27.625 22.8625 36-37 22.0 29.1375 27.1125 21.75 38-39 22.025 27.9125 27.575 22.4875 40-41 21.65 28.037499999999998 27.962500000000002 22.35 42-43 21.3625 28.1625 27.6625 22.8125 44-45 22.075 27.9125 27.6 22.412499999999998 46-47 21.7875 27.712500000000002 27.975 22.525000000000002 48-49 21.5 28.175 28.375 21.95 50-51 21.275 28.212500000000002 28.075 22.4375 52-53 22.025 28.575 27.700000000000003 21.7 54-55 22.225 28.125 29.0875 20.5625 56-57 22.4875 27.9375 27.762500000000003 21.8125 58-59 21.7 29.1125 28.249999999999996 20.9375 60-61 22.425 27.1 28.6875 21.7875 62-63 21.375 28.5625 28.249999999999996 21.8125 64-65 21.337500000000002 28.449999999999996 27.9375 22.275 66-67 21.4125 29.4 28.1125 21.075 68-69 22.225 28.175 27.762500000000003 21.837500000000002 70-71 22.0125 26.875 28.625 22.4875 72-73 21.087500000000002 28.6625 28.050000000000004 22.2 74-75 20.9875 28.6875 28.712500000000002 21.6125 76-77 22.7625 28.349999999999998 27.737499999999997 21.15 78-79 22.412499999999998 27.737499999999997 28.6375 21.212500000000002 80-81 22.8375 26.924999999999997 28.3875 21.85 82-83 21.837500000000002 28.287499999999998 28.000000000000004 21.875 84-85 21.349999999999998 28.625 28.512500000000003 21.512500000000003 86-87 22.412499999999998 29.225 26.987499999999997 21.375 88-89 22.125 28.225 28.037499999999998 21.6125 90-91 21.7 27.925 28.249999999999996 22.125 92-93 22.2625 27.950000000000003 28.212500000000002 21.575 94-95 22.475 28.1375 27.575 21.8125 96-97 21.525 29.099999999999998 27.6625 21.712500000000002 98-99 22.8125 28.0875 28.575 20.525 100 22.175 28.4 27.1 22.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.5 23 1.5 24 3.5 25 4.0 26 4.5 27 6.0 28 8.5 29 14.5 30 19.0 31 29.5 32 39.0 33 44.0 34 65.0 35 77.0 36 86.5 37 119.0 38 162.5 39 176.0 40 179.5 41 210.5 42 232.5 43 261.0 44 280.5 45 273.5 46 280.0 47 259.5 48 214.5 49 183.5 50 164.5 51 134.5 52 99.5 53 81.5 54 64.5 55 56.0 56 42.0 57 29.0 58 21.0 59 14.0 60 11.5 61 6.0 62 7.0 63 8.5 64 4.5 65 2.0 66 1.0 67 1.0 68 2.5 69 2.5 70 1.5 71 1.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2125 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568220 spots for SRR3207800.sra Written 1568220 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra Read 1568204 spots for SRR3207800.sra Written 1568204 spots for SRR3207800.sra SRR ids: ['SRR3207800.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_31345lrp SRR3207800.sra spots: 31364096 blocks: [[1, 1568204], [1568205, 3136408], [3136409, 4704612], [4704613, 6272816], [6272817, 7841020], [7841021, 9409224], [9409225, 10977428], [10977429, 12545632], [12545633, 14113836], [14113837, 15682040], [15682041, 17250244], [17250245, 18818448], [18818449, 20386652], [20386653, 21954856], [21954857, 23523060], [23523061, 25091264], [25091265, 26659468], [26659469, 28227672], [28227673, 29795876], [29795877, 31364096]] SRR3207800 file size 8151612 SRR3207800 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207800 SRR3207800_1.fastq Input file: SRR3207800_1.fastq trimmed: SRR3207800-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 23:53:33 2025 >> started Mon Feb 10 23:53:51 2025 >> done (18.220s) 31364096 reads processed; of these: 3830 ( 0.01%) short reads filtered out after trimming by size control 11077 ( 0.04%) empty reads filtered out after trimming by size control 31349189 (99.95%) reads available; of these: 1936694 ( 6.18%) trimmed reads available after processing 29412495 (93.82%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 696 0.00% 19 830 0.00% 20 1101 0.00% 21 1474 0.00% 22 1974 0.01% 23 2805 0.01% 24 3575 0.01% 25 4396 0.01% 26 4658 0.01% 27 4657 0.01% 28 4627 0.01% 29 4927 0.02% 30 5034 0.02% 31 5135 0.02% 32 5388 0.02% 33 5200 0.02% 34 5476 0.02% 35 5586 0.02% 36 5888 0.02% 37 5951 0.02% 38 6163 0.02% 39 6180 0.02% 40 6277 0.02% 41 6325 0.02% 42 6625 0.02% 43 7216 0.02% 44 8881 0.03% 45 8729 0.03% 46 8590 0.03% 47 8905 0.03% 48 9200 0.03% 49 9219 0.03% 50 9465 0.03% 51 9908 0.03% 52 10169 0.03% 53 10434 0.03% 54 10556 0.03% 55 10979 0.04% 56 11057 0.04% 57 11584 0.04% 58 11781 0.04% 59 11884 0.04% 60 12090 0.04% 61 12380 0.04% 62 12869 0.04% 63 12734 0.04% 64 13336 0.04% 65 14121 0.05% 66 15543 0.05% 67 15422 0.05% 68 15662 0.05% 69 15746 0.05% 70 16635 0.05% 71 17133 0.05% 72 18325 0.06% 73 18633 0.06% 74 18819 0.06% 75 18945 0.06% 76 13698 0.04% 77 15590 0.05% 78 17744 0.06% 79 19117 0.06% 80 20386 0.07% 81 21434 0.07% 82 23493 0.07% 83 25564 0.08% 84 26657 0.09% 85 29458 0.09% 86 31396 0.10% 87 32469 0.10% 88 35392 0.11% 89 38468 0.12% 90 42672 0.14% 91 48118 0.15% 92 54762 0.17% 93 63103 0.20% 94 75896 0.24% 95 92957 0.30% 96 119259 0.38% 97 154187 0.49% 98 192328 0.61% 99 214648 0.68% 100 29412495 93.82% 31349189 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=61.98 fanout-score-rank=5 prefix-density=1.03 prefix-fanout=41.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=13 fanout-score=191.21 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=23.2 sequence=AAGAAGAAGAAA Started job on | Feb 10 23:54:07 Started mapping on | Feb 10 23:54:07 Finished on | Feb 10 23:54:36 Mapping speed, Million of reads per hour | 3891.62 Number of input reads | 31349189 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 30201354 Uniquely mapped reads % | 96.34% Average mapped length | 98.58 Number of splices: Total | 8462375 Number of splices: Annotated (sjdb) | 8311765 Number of splices: GT/AG | 8337601 Number of splices: GC/AG | 102095 Number of splices: AT/AC | 7993 Number of splices: Non-canonical | 14686 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 705038 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 311754 % of reads mapped to too many loci | 0.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 442797 442797 442797 N_multimapping 705038 705038 705038 N_noFeature 1189328 15539496 15603943 N_ambiguous 344868 48547 49574 UnstrandedReadsAssigned:28667158 PositiveStrandReadsAssigned:14613311 NegativeStrandReadsAssigned:14547837 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207800 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207800-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,349,189 reads, 29,515,233 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,245 rounds 52401 SRR3207800.ke.tsv 34699 SRR3207800.se.tsv 87100 total ==> SRR3207800.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 853 21.0736 Potri.005G024800.1.v4.1 1035 936 91 4.60924 Potri.004G059700.1.v4.1 961 862 46 2.52996 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 448.72 7.48014 Potri.016G087400.1.v4.1 270 171 1569 435.001 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 75 2.12407 Potri.012G127500.1.v4.1 977 878 3880 209.508 ==> SRR3207800.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2769 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 573 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 59 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 11 SRR3207800 completed mapping pipeline successfully