Starting /dee2/code/volunteer_pipeline.sh SRR3207801 current disk space = 3057290584064 free memory = 1580044888 SRR3207801 SRAfilesize c71ee95a3c2c8bf2c5fba132703eccb4 SRR3207801.sra SRR3207801.sra file validated SRR3207801 is single end SRR3207801 is conventional basespace SRR3207801 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207801_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49175 34.0 33.0 34.0 31.0 34.0 2 32.93125 34.0 33.0 34.0 31.0 34.0 3 33.22825 34.0 34.0 34.0 31.0 34.0 4 36.571 37.0 37.0 37.0 35.0 37.0 5 36.47725 37.0 37.0 37.0 35.0 37.0 6 36.5555 37.0 37.0 37.0 35.0 37.0 7 36.47675 37.0 37.0 37.0 35.0 37.0 8 36.48675 37.0 37.0 37.0 35.0 37.0 9 38.39875 39.0 39.0 39.0 37.0 39.0 10-11 38.436499999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.320375 39.0 39.0 39.0 37.0 39.0 14-15 39.970625 41.0 40.0 41.0 38.0 41.0 16-17 39.876625000000004 41.0 40.0 41.0 38.0 41.0 18-19 39.845124999999996 41.0 40.0 41.0 38.0 41.0 20-21 39.8545 41.0 40.0 41.0 38.0 41.0 22-23 39.718 41.0 40.0 41.0 37.0 41.0 24-25 39.691874999999996 41.0 40.0 41.0 37.0 41.0 26-27 39.615375 41.0 40.0 41.0 37.0 41.0 28-29 39.480125 41.0 39.0 41.0 37.0 41.0 30-31 39.279875 40.5 39.0 41.0 36.5 41.0 32-33 39.249624999999995 41.0 39.0 41.0 36.5 41.0 34-35 39.229 41.0 39.0 41.0 36.0 41.0 36-37 39.063125 41.0 39.0 41.0 36.0 41.0 38-39 39.004000000000005 40.5 39.0 41.0 36.0 41.0 40-41 38.8595 40.5 38.5 41.0 35.0 41.0 42-43 39.2 41.0 39.0 41.0 36.0 41.0 44-45 39.163 41.0 39.0 41.0 36.0 41.0 46-47 39.1545 41.0 39.0 41.0 36.0 41.0 48-49 38.9885 41.0 39.0 41.0 35.5 41.0 50-51 38.882625000000004 41.0 39.0 41.0 35.0 41.0 52-53 38.75 41.0 39.0 41.0 35.0 41.0 54-55 38.461 40.0 38.0 41.0 34.5 41.0 56-57 38.34075 40.0 38.0 41.0 34.5 41.0 58-59 38.10875 40.0 38.0 41.0 34.0 41.0 60-61 37.835499999999996 40.0 37.0 41.0 34.0 41.0 62-63 37.60225 40.0 37.0 41.0 33.5 41.0 64-65 37.2745 39.0 36.0 41.0 33.0 41.0 66-67 36.823125000000005 39.0 35.5 41.0 32.0 41.0 68-69 36.471625 38.5 35.0 40.0 32.0 41.0 70-71 35.994125 37.0 35.0 39.5 32.0 41.0 72-73 35.540625000000006 37.0 35.0 39.0 31.0 41.0 74-75 35.044624999999996 36.0 35.0 39.0 31.0 40.0 76-77 34.005250000000004 35.0 33.5 37.0 29.5 39.0 78-79 34.181124999999994 35.0 34.0 37.0 30.5 39.0 80-81 33.966499999999996 35.0 34.0 36.5 30.0 38.0 82-83 33.679875 35.0 34.0 36.0 30.5 37.0 84-85 33.405 35.0 34.0 36.0 30.0 37.0 86-87 33.12875 35.0 34.0 35.0 29.5 36.5 88-89 32.895875000000004 35.0 34.0 35.0 29.0 36.0 90-91 32.626125 35.0 34.0 35.0 29.0 36.0 92-93 32.432 35.0 34.0 35.0 29.0 36.0 94-95 32.286125 35.0 33.5 35.0 29.0 35.0 96-97 32.088875 35.0 34.0 35.0 27.5 35.0 98-99 31.858 35.0 33.0 35.0 27.0 35.0 100 31.60575 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 6.0 12 6.0 13 7.0 14 3.0 15 2.0 16 8.0 17 5.0 18 7.0 19 3.0 20 9.0 21 12.0 22 9.0 23 6.0 24 7.0 25 12.0 26 15.0 27 16.0 28 18.0 29 32.0 30 37.0 31 42.0 32 73.0 33 64.0 34 113.0 35 183.0 36 358.0 37 946.0 38 1662.0 39 336.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.824910668708522 14.446145992853495 17.611026033690656 41.11791730474732 2 19.42914371557336 23.059589384076116 37.25588382573861 20.255383074611917 3 22.475 28.749999999999996 26.200000000000003 22.575 4 24.099999999999998 33.375 19.15 23.375 5 24.075 35.925000000000004 22.475 17.525 6 18.0 37.925 24.675 19.400000000000002 7 16.225 18.3 43.375 22.1 8 18.75 24.775 28.625 27.85 9 20.875 22.875 31.0 25.25 10-11 22.3875 34.4875 22.775000000000002 20.349999999999998 12-13 20.2625 26.7625 29.3875 23.5875 14-15 21.125 27.6875 28.4125 22.775000000000002 16-17 22.475 27.425 28.787499999999998 21.3125 18-19 22.1 28.65 26.8375 22.412499999999998 20-21 22.537499999999998 27.6625 27.85 21.95 22-23 22.0125 28.675 26.974999999999998 22.3375 24-25 21.0 28.775000000000002 27.487499999999997 22.7375 26-27 22.237499999999997 27.6 27.575 22.5875 28-29 22.2 28.8375 26.674999999999997 22.287499999999998 30-31 22.225 27.700000000000003 28.462500000000002 21.6125 32-33 21.4125 28.262500000000003 28.037499999999998 22.287499999999998 34-35 21.837500000000002 29.225 27.0125 21.925 36-37 21.775 27.9125 28.1 22.2125 38-39 22.075 28.487499999999997 27.224999999999998 22.2125 40-41 21.912499999999998 28.487499999999997 27.675 21.925 42-43 20.974999999999998 28.499999999999996 28.0625 22.4625 44-45 21.7 28.7375 27.6 21.9625 46-47 21.875 28.849999999999998 26.387500000000003 22.8875 48-49 22.0 27.437499999999996 27.8375 22.725 50-51 21.9625 27.700000000000003 27.6625 22.675 52-53 21.775 27.462500000000002 28.1375 22.625 54-55 22.0 27.775 27.3 22.925 56-57 22.225 28.425 27.900000000000002 21.45 58-59 22.0625 28.1125 27.3375 22.4875 60-61 21.6875 28.5875 28.050000000000004 21.675 62-63 21.6125 28.512500000000003 27.725 22.15 64-65 21.675 28.725 27.775 21.825 66-67 22.3 28.299999999999997 27.8375 21.5625 68-69 22.237499999999997 27.55 27.9375 22.275 70-71 21.5625 28.012500000000003 27.925 22.5 72-73 22.3 27.787499999999998 27.8125 22.1 74-75 22.15 27.462500000000002 28.725 21.6625 76-77 21.6875 28.537499999999998 27.700000000000003 22.075 78-79 21.625 28.537499999999998 28.8625 20.974999999999998 80-81 22.15 28.262500000000003 27.3375 22.25 82-83 20.925 27.200000000000003 29.2 22.675 84-85 21.675 28.1625 27.212500000000002 22.95 86-87 21.8125 28.3875 28.299999999999997 21.5 88-89 22.615326915864483 27.55344418052256 27.703462932866607 22.127765970746342 90-91 22.112499999999997 28.075 27.8625 21.95 92-93 22.925 27.85 27.750000000000004 21.475 94-95 22.325 27.950000000000003 27.787499999999998 21.9375 96-97 21.875 28.1375 27.8875 22.1 98-99 22.475 28.725 27.6875 21.1125 100 23.0 26.700000000000003 27.425 22.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.5 22 2.0 23 0.5 24 2.0 25 2.5 26 1.0 27 2.0 28 7.0 29 13.5 30 17.0 31 18.0 32 29.0 33 44.5 34 55.0 35 74.0 36 100.0 37 123.5 38 137.5 39 154.0 40 180.0 41 212.5 42 242.0 43 255.5 44 256.0 45 281.0 46 289.5 47 268.5 48 250.5 49 200.5 50 149.5 51 127.5 52 113.5 53 100.0 54 74.0 55 45.0 56 37.0 57 30.5 58 21.0 59 15.5 60 10.5 61 8.0 62 11.0 63 8.5 64 5.5 65 4.5 66 2.0 67 1.0 68 0.5 69 1.0 70 1.5 71 1.5 72 1.5 73 1.0 74 1.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra Read 1885071 spots for SRR3207801.sra Written 1885071 spots for SRR3207801.sra Read 1885061 spots for SRR3207801.sra Written 1885061 spots for SRR3207801.sra SRR ids: ['SRR3207801.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dgqwmtwa SRR3207801.sra spots: 37701230 blocks: [[1, 1885061], [1885062, 3770122], [3770123, 5655183], [5655184, 7540244], [7540245, 9425305], [9425306, 11310366], [11310367, 13195427], [13195428, 15080488], [15080489, 16965549], [16965550, 18850610], [18850611, 20735671], [20735672, 22620732], [22620733, 24505793], [24505794, 26390854], [26390855, 28275915], [28275916, 30160976], [30160977, 32046037], [32046038, 33931098], [33931099, 35816159], [35816160, 37701230]] SRR3207801 file size 9800838 SRR3207801 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207801 SRR3207801_1.fastq Input file: SRR3207801_1.fastq trimmed: SRR3207801-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 00:34:20 2025 >> started Tue Feb 11 00:34:40 2025 >> done (19.276s) 37701230 reads processed; of these: 4878 ( 0.01%) short reads filtered out after trimming by size control 13912 ( 0.04%) empty reads filtered out after trimming by size control 37682440 (99.95%) reads available; of these: 2391918 ( 6.35%) trimmed reads available after processing 35290522 (93.65%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 896 0.00% 19 1140 0.00% 20 1422 0.00% 21 1886 0.01% 22 2421 0.01% 23 3515 0.01% 24 4377 0.01% 25 5561 0.01% 26 5728 0.02% 27 5704 0.02% 28 5733 0.02% 29 5985 0.02% 30 6252 0.02% 31 6329 0.02% 32 6558 0.02% 33 6458 0.02% 34 6946 0.02% 35 7071 0.02% 36 7158 0.02% 37 7402 0.02% 38 7339 0.02% 39 7746 0.02% 40 7677 0.02% 41 7739 0.02% 42 8280 0.02% 43 8885 0.02% 44 10945 0.03% 45 10904 0.03% 46 10706 0.03% 47 10891 0.03% 48 11173 0.03% 49 11522 0.03% 50 11641 0.03% 51 12317 0.03% 52 12590 0.03% 53 12785 0.03% 54 13162 0.03% 55 13715 0.04% 56 13665 0.04% 57 14124 0.04% 58 14325 0.04% 59 14646 0.04% 60 14962 0.04% 61 15252 0.04% 62 15680 0.04% 63 15974 0.04% 64 16227 0.04% 65 17216 0.05% 66 17527 0.05% 67 18527 0.05% 68 18827 0.05% 69 19610 0.05% 70 20399 0.05% 71 21637 0.06% 72 22560 0.06% 73 23201 0.06% 74 23750 0.06% 75 23471 0.06% 76 16615 0.04% 77 19100 0.05% 78 22145 0.06% 79 23698 0.06% 80 25404 0.07% 81 26930 0.07% 82 28930 0.08% 83 31743 0.08% 84 32926 0.09% 85 36212 0.10% 86 38291 0.10% 87 39649 0.11% 88 43890 0.12% 89 47325 0.13% 90 52380 0.14% 91 59179 0.16% 92 67726 0.18% 93 78449 0.21% 94 94104 0.25% 95 114950 0.31% 96 147328 0.39% 97 190622 0.51% 98 238717 0.63% 99 265466 0.70% 100 35290522 93.65% 37682440 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=29.97 fanout-score-rank=5 prefix-density=0.20 prefix-fanout=24.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=17 fanout-score=165.33 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=22.6 sequence=AAGAAGAAGAAA Started job on | Feb 11 00:34:57 Started mapping on | Feb 11 00:34:57 Finished on | Feb 11 00:35:26 Mapping speed, Million of reads per hour | 4677.82 Number of input reads | 37682440 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 36275071 Uniquely mapped reads % | 96.27% Average mapped length | 98.71 Number of splices: Total | 10468520 Number of splices: Annotated (sjdb) | 10290264 Number of splices: GT/AG | 10316527 Number of splices: GC/AG | 125107 Number of splices: AT/AC | 10222 Number of splices: Non-canonical | 16664 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.02% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 835136 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 402123 % of reads mapped to too many loci | 1.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.44% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 572233 572233 572233 N_multimapping 835136 835136 835136 N_noFeature 1415529 18695812 18738693 N_ambiguous 375055 58855 60532 UnstrandedReadsAssigned:34484487 PositiveStrandReadsAssigned:17520404 NegativeStrandReadsAssigned:17475846 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207801 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207801-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,682,440 reads, 35,515,981 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52401 SRR3207801.ke.tsv 34699 SRR3207801.se.tsv 87100 total ==> SRR3207801.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1129 24.7679 Potri.005G024800.1.v4.1 1035 936 101 4.54272 Potri.004G059700.1.v4.1 961 862 31 1.514 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 571.899 8.46564 Potri.016G087400.1.v4.1 270 171 1544 380.121 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 148.586 3.73674 Potri.012G127500.1.v4.1 977 878 3555 170.457 ==> SRR3207801.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3589 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 643 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 70 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR3207801 completed mapping pipeline successfully