Starting /dee2/code/volunteer_pipeline.sh SRR3207802 current disk space = 3057425960960 free memory = 1504233160 SRR3207802 SRAfilesize 3ce8df186e292dcf44ab1375cfe943a8 SRR3207802.sra SRR3207802.sra file validated SRR3207802 is single end SRR3207802 is conventional basespace SRR3207802 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207802_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.605 34.0 33.0 34.0 31.0 34.0 2 32.95825 34.0 33.0 34.0 31.0 34.0 3 33.26475 34.0 34.0 34.0 31.0 34.0 4 36.5815 37.0 37.0 37.0 35.0 37.0 5 36.515 37.0 37.0 37.0 35.0 37.0 6 36.58725 37.0 37.0 37.0 35.0 37.0 7 36.51 37.0 37.0 37.0 35.0 37.0 8 36.49925 37.0 37.0 37.0 35.0 37.0 9 38.44625 39.0 39.0 39.0 37.0 39.0 10-11 38.474000000000004 39.0 39.0 39.0 37.0 39.0 12-13 38.400875 39.0 39.0 39.0 37.0 39.0 14-15 39.970375 41.0 40.0 41.0 38.0 41.0 16-17 39.855875 41.0 40.0 41.0 38.0 41.0 18-19 39.93825 41.0 40.0 41.0 38.0 41.0 20-21 39.909875 41.0 40.0 41.0 38.0 41.0 22-23 39.788 41.0 40.0 41.0 38.0 41.0 24-25 39.733125 41.0 40.0 41.0 37.5 41.0 26-27 39.686499999999995 41.0 40.0 41.0 37.5 41.0 28-29 39.5005 41.0 39.5 41.0 37.0 41.0 30-31 39.342124999999996 40.5 39.0 41.0 36.5 41.0 32-33 39.380625 41.0 39.0 41.0 36.5 41.0 34-35 39.277625 41.0 39.0 41.0 36.0 41.0 36-37 39.204625 41.0 39.0 41.0 36.0 41.0 38-39 39.168125 41.0 39.0 41.0 36.0 41.0 40-41 39.109625 40.5 39.0 41.0 36.0 41.0 42-43 39.3995 41.0 39.5 41.0 37.0 41.0 44-45 39.318375 41.0 40.0 41.0 37.0 41.0 46-47 39.211 41.0 39.0 41.0 36.5 41.0 48-49 39.1425 41.0 39.0 41.0 36.0 41.0 50-51 39.022 41.0 39.0 41.0 35.5 41.0 52-53 38.846625 41.0 39.0 41.0 35.0 41.0 54-55 38.611125 40.0 38.5 41.0 35.0 41.0 56-57 38.4925 40.0 38.0 41.0 34.5 41.0 58-59 38.324875 40.0 38.0 41.0 34.0 41.0 60-61 38.060874999999996 40.0 37.0 41.0 34.0 41.0 62-63 37.891999999999996 40.0 37.0 41.0 34.0 41.0 64-65 37.592375 39.0 36.5 41.0 33.5 41.0 66-67 37.077875 39.0 36.0 41.0 32.5 41.0 68-69 36.790625 38.5 35.0 40.0 33.0 41.0 70-71 36.209375 37.0 35.0 39.5 31.5 41.0 72-73 35.709 37.0 35.0 39.0 31.5 41.0 74-75 35.228 36.0 35.0 39.0 31.0 39.5 76-77 34.171625 35.0 34.0 37.0 29.5 39.0 78-79 34.2725 35.0 34.0 37.0 30.5 39.0 80-81 34.026250000000005 35.0 34.0 37.0 30.5 38.0 82-83 33.65725 35.0 34.0 36.0 30.0 37.0 84-85 33.454499999999996 35.0 34.0 36.0 30.0 37.0 86-87 33.200125 35.0 34.0 35.5 30.0 36.5 88-89 32.9705 35.0 34.0 35.0 29.5 36.0 90-91 32.709375 35.0 34.0 35.0 29.0 36.0 92-93 32.4905 35.0 34.0 35.0 29.0 36.0 94-95 32.347625 35.0 34.0 35.0 29.0 35.0 96-97 32.101 35.0 33.0 35.0 28.0 35.0 98-99 31.892125 35.0 33.0 35.0 27.0 35.0 100 31.716 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 6.0 12 2.0 13 3.0 14 3.0 15 4.0 16 3.0 17 6.0 18 4.0 19 11.0 20 4.0 21 10.0 22 6.0 23 6.0 24 10.0 25 10.0 26 22.0 27 20.0 28 16.0 29 29.0 30 32.0 31 44.0 32 56.0 33 62.0 34 114.0 35 179.0 36 365.0 37 895.0 38 1714.0 39 361.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.503304524656837 14.921199796644636 17.590238942552112 36.98525673614642 2 19.739478957915832 24.473947895791586 36.49799599198397 19.288577154308616 3 22.325 26.674999999999997 28.025 22.975 4 24.4 33.4 20.45 21.75 5 23.625 36.65 21.275 18.45 6 17.974999999999998 38.275 23.625 20.125 7 16.0 18.025 44.224999999999994 21.75 8 18.85 21.95 30.3 28.9 9 20.7 23.599999999999998 30.725 24.975 10-11 23.0375 33.3375 21.9 21.725 12-13 19.6 27.8125 29.475 23.1125 14-15 21.675 28.075 28.262500000000003 21.987499999999997 16-17 22.652831603950492 28.22852856607076 27.315914489311165 21.802725340667585 18-19 21.7 28.212500000000002 27.625 22.4625 20-21 20.6875 28.0625 27.725 23.525 22-23 21.712500000000002 28.1625 27.487499999999997 22.6375 24-25 21.9625 28.375 27.875 21.7875 26-27 21.3125 29.299999999999997 27.175 22.2125 28-29 21.7875 27.675 28.5625 21.975 30-31 21.775 28.775000000000002 28.037499999999998 21.4125 32-33 21.2625 27.825 28.1875 22.725 34-35 21.95 28.475 27.925 21.65 36-37 21.224999999999998 28.599999999999998 27.425 22.75 38-39 21.5375 28.575 27.5125 22.375 40-41 20.9125 28.487499999999997 28.199999999999996 22.400000000000002 42-43 20.974999999999998 28.925 27.6125 22.4875 44-45 21.4 28.025 27.35 23.225 46-47 21.637500000000003 28.6125 27.474999999999998 22.275 48-49 22.5875 27.6875 27.487499999999997 22.237499999999997 50-51 22.3 28.275 26.987499999999997 22.4375 52-53 22.575 28.237499999999997 27.750000000000004 21.4375 54-55 22.1375 28.4125 27.750000000000004 21.7 56-57 22.1 27.987499999999997 27.650000000000002 22.2625 58-59 22.15 27.875 27.237499999999997 22.7375 60-61 21.675 28.4375 27.6375 22.25 62-63 21.8875 28.749999999999996 27.3625 22.0 64-65 22.05 28.575 27.1375 22.237499999999997 66-67 22.5625 28.050000000000004 27.6875 21.7 68-69 22.5125 27.987499999999997 28.575 20.925 70-71 22.7375 28.825 26.674999999999997 21.762500000000003 72-73 21.637500000000003 28.225 27.962500000000002 22.175 74-75 21.587500000000002 27.6625 28.175 22.575 76-77 21.7375 28.999999999999996 26.5625 22.7 78-79 22.45 27.125 28.787499999999998 21.637500000000003 80-81 22.7125 27.8875 27.625 21.775 82-83 22.162499999999998 28.4 27.537499999999998 21.9 84-85 22.6875 28.1875 26.9125 22.2125 86-87 20.974999999999998 28.037499999999998 28.449999999999996 22.537499999999998 88-89 21.790223777972244 27.090886360795096 29.066133266658333 22.052756594574323 90-91 20.6875 28.812500000000004 27.8875 22.6125 92-93 21.65 28.375 28.462500000000002 21.512500000000003 94-95 22.8 27.6375 27.462500000000002 22.1 96-97 21.5375 28.537499999999998 27.8125 22.112499999999997 98-99 21.5625 28.262500000000003 27.775 22.400000000000002 100 22.95 28.575 26.25 22.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 0.5 25 1.0 26 3.5 27 6.5 28 11.0 29 14.0 30 21.5 31 25.5 32 27.5 33 44.5 34 59.5 35 62.0 36 76.5 37 108.5 38 149.0 39 178.0 40 187.5 41 215.0 42 250.0 43 262.0 44 260.0 45 281.0 46 287.0 47 258.5 48 226.5 49 193.5 50 160.0 51 127.5 52 101.5 53 87.0 54 73.5 55 48.5 56 36.5 57 34.5 58 28.5 59 18.5 60 14.0 61 11.0 62 6.0 63 5.0 64 5.0 65 4.0 66 2.5 67 3.0 68 3.0 69 2.0 70 2.5 71 2.5 72 1.0 73 0.5 74 1.0 75 1.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0125 0.025 0.0 0.0 0.0 84-85 0.075 0.025 0.0 0.0 0.0 86-87 0.075 0.025 0.0 0.0 0.0 88 0.1 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289015 spots for SRR3207802.sra Written 1289015 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra Read 1289006 spots for SRR3207802.sra Written 1289006 spots for SRR3207802.sra SRR ids: ['SRR3207802.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0mbb1r11 SRR3207802.sra spots: 25780129 blocks: [[1, 1289006], [1289007, 2578012], [2578013, 3867018], [3867019, 5156024], [5156025, 6445030], [6445031, 7734036], [7734037, 9023042], [9023043, 10312048], [10312049, 11601054], [11601055, 12890060], [12890061, 14179066], [14179067, 15468072], [15468073, 16757078], [16757079, 18046084], [18046085, 19335090], [19335091, 20624096], [20624097, 21913102], [21913103, 23202108], [23202109, 24491114], [24491115, 25780129]] SRR3207802 file size 6698389 SRR3207802 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207802 SRR3207802_1.fastq Input file: SRR3207802_1.fastq trimmed: SRR3207802-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 00:10:40 2025 >> started Tue Feb 11 00:10:53 2025 >> done (12.879s) 25780129 reads processed; of these: 3081 ( 0.01%) short reads filtered out after trimming by size control 8453 ( 0.03%) empty reads filtered out after trimming by size control 25768595 (99.96%) reads available; of these: 1604785 ( 6.23%) trimmed reads available after processing 24163810 (93.77%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 588 0.00% 19 718 0.00% 20 1035 0.00% 21 1269 0.00% 22 1737 0.01% 23 2470 0.01% 24 3156 0.01% 25 3907 0.02% 26 3890 0.02% 27 3980 0.02% 28 3957 0.02% 29 4308 0.02% 30 4320 0.02% 31 4426 0.02% 32 4604 0.02% 33 4465 0.02% 34 4726 0.02% 35 4918 0.02% 36 5047 0.02% 37 5266 0.02% 38 5208 0.02% 39 5244 0.02% 40 5758 0.02% 41 5515 0.02% 42 5717 0.02% 43 6275 0.02% 44 7671 0.03% 45 7315 0.03% 46 7445 0.03% 47 7466 0.03% 48 7725 0.03% 49 7846 0.03% 50 8008 0.03% 51 8300 0.03% 52 8648 0.03% 53 8906 0.03% 54 9016 0.03% 55 9200 0.04% 56 9249 0.04% 57 9597 0.04% 58 9980 0.04% 59 9720 0.04% 60 10030 0.04% 61 10333 0.04% 62 10839 0.04% 63 10518 0.04% 64 10848 0.04% 65 11362 0.04% 66 11741 0.05% 67 12372 0.05% 68 12564 0.05% 69 13065 0.05% 70 13732 0.05% 71 14596 0.06% 72 15213 0.06% 73 15536 0.06% 74 15637 0.06% 75 15964 0.06% 76 11160 0.04% 77 12912 0.05% 78 14688 0.06% 79 15694 0.06% 80 16922 0.07% 81 17829 0.07% 82 19406 0.08% 83 21480 0.08% 84 22103 0.09% 85 24166 0.09% 86 25515 0.10% 87 26674 0.10% 88 29000 0.11% 89 31701 0.12% 90 35090 0.14% 91 40044 0.16% 92 44985 0.17% 93 51909 0.20% 94 62705 0.24% 95 76558 0.30% 96 98022 0.38% 97 126915 0.49% 98 159684 0.62% 99 176677 0.69% 100 24163810 93.77% 25768595 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=6.66 fanout-score-rank=19 prefix-density=0.04 prefix-fanout=6.7 sequence=AGATCGGAAGAGCACACGTCTGAACT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=262.45 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=26.7 sequence=TTCTTCTTCTTT Started job on | Feb 11 00:11:08 Started mapping on | Feb 11 00:11:08 Finished on | Feb 11 00:11:31 Mapping speed, Million of reads per hour | 4033.35 Number of input reads | 25768595 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 24595929 Uniquely mapped reads % | 95.45% Average mapped length | 98.77 Number of splices: Total | 7222335 Number of splices: Annotated (sjdb) | 7099849 Number of splices: GT/AG | 7116762 Number of splices: GC/AG | 87328 Number of splices: AT/AC | 6873 Number of splices: Non-canonical | 11372 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.99 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 574268 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 483147 % of reads mapped to too many loci | 1.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.43% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 598398 598398 598398 N_multimapping 574268 574268 574268 N_noFeature 1001742 12700190 12734018 N_ambiguous 244017 39994 40881 UnstrandedReadsAssigned:23350170 PositiveStrandReadsAssigned:11855745 NegativeStrandReadsAssigned:11821030 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207802 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207802-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,768,595 reads, 24,227,478 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR3207802.ke.tsv 34699 SRR3207802.se.tsv 87100 total ==> SRR3207802.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 686 22.0529 Potri.005G024800.1.v4.1 1035 936 52 3.42724 Potri.004G059700.1.v4.1 961 862 16 1.14507 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 415.442 9.01152 Potri.016G087400.1.v4.1 270 171 1089 392.87 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 90 3.31669 Potri.012G127500.1.v4.1 977 878 3031 212.965 ==> SRR3207802.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2465 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 467 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 43 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207802 completed mapping pipeline successfully