Starting /dee2/code/volunteer_pipeline.sh SRR3207803 current disk space = 3057302618112 free memory = 1572060488 SRR3207803 SRAfilesize 9a3bce775cf8dc83d47026c3631c8412 SRR3207803.sra SRR3207803.sra file validated SRR3207803 is single end SRR3207803 is conventional basespace SRR3207803 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207803_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94325 34.0 33.0 34.0 31.0 34.0 2 33.24725 34.0 34.0 34.0 31.0 34.0 3 33.49225 34.0 34.0 34.0 31.0 34.0 4 36.71425 37.0 37.0 37.0 35.0 37.0 5 36.68925 37.0 37.0 37.0 35.0 37.0 6 36.71175 37.0 37.0 37.0 35.0 37.0 7 36.6215 37.0 37.0 37.0 35.0 37.0 8 36.67175 37.0 37.0 37.0 35.0 37.0 9 38.6495 39.0 39.0 39.0 38.0 39.0 10-11 38.586749999999995 39.0 39.0 39.0 38.0 39.0 12-13 38.517875 39.0 39.0 39.0 37.5 39.0 14-15 40.184625 41.0 40.0 41.0 38.0 41.0 16-17 40.192750000000004 41.0 40.0 41.0 38.5 41.0 18-19 40.115875 41.0 40.0 41.0 38.5 41.0 20-21 40.170375 41.0 40.0 41.0 39.0 41.0 22-23 40.13875 41.0 40.0 41.0 38.5 41.0 24-25 40.020250000000004 41.0 40.0 41.0 38.0 41.0 26-27 39.954125 41.0 40.0 41.0 38.0 41.0 28-29 39.860375000000005 41.0 40.0 41.0 38.0 41.0 30-31 39.698125000000005 41.0 40.0 41.0 38.0 41.0 32-33 39.7305 41.0 40.0 41.0 38.0 41.0 34-35 39.744375 41.0 40.0 41.0 38.0 41.0 36-37 39.60425 41.0 40.0 41.0 37.0 41.0 38-39 39.603 41.0 40.0 41.0 37.5 41.0 40-41 39.611999999999995 41.0 40.0 41.0 37.5 41.0 42-43 39.729 41.0 40.0 41.0 38.0 41.0 44-45 39.650875 41.0 40.0 41.0 37.5 41.0 46-47 39.610125 41.0 40.0 41.0 37.5 41.0 48-49 39.564 41.0 40.0 41.0 37.0 41.0 50-51 39.4105 41.0 40.0 41.0 37.0 41.0 52-53 39.3255 41.0 39.0 41.0 36.5 41.0 54-55 39.128625 41.0 39.0 41.0 36.0 41.0 56-57 38.932874999999996 41.0 39.0 41.0 35.0 41.0 58-59 38.793125 41.0 39.0 41.0 35.0 41.0 60-61 38.56325 40.5 38.0 41.0 35.0 41.0 62-63 38.21375 40.0 37.0 41.0 34.5 41.0 64-65 38.026250000000005 39.5 37.0 41.0 34.5 41.0 66-67 37.72825 39.0 36.0 41.0 34.0 41.0 68-69 37.28625 39.0 36.0 40.5 34.0 41.0 70-71 36.861625000000004 37.5 35.0 39.5 34.0 41.0 72-73 36.33475 37.0 35.0 39.0 33.0 41.0 74-75 35.879999999999995 36.5 35.0 39.0 33.0 40.5 76-77 34.99025 35.5 34.5 37.0 31.5 39.0 78-79 34.93075 35.5 35.0 37.0 32.5 39.0 80-81 34.67675 35.0 35.0 37.0 32.0 39.0 82-83 34.534 35.0 35.0 36.0 32.5 37.0 84-85 34.260875 35.0 35.0 36.0 32.0 37.0 86-87 33.984875 35.0 35.0 36.0 32.0 36.5 88-89 33.95575 35.0 35.0 35.0 32.0 36.0 90-91 33.7445 35.0 35.0 35.0 32.0 36.0 92-93 33.616125 35.0 34.0 35.0 32.0 36.0 94-95 33.44525 35.0 34.0 35.0 31.5 36.0 96-97 33.391625000000005 35.0 34.0 35.0 31.5 35.0 98-99 33.203875 35.0 34.0 35.0 31.0 35.0 100 33.1325 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 5.0 12 2.0 13 3.0 14 1.0 15 5.0 16 2.0 17 4.0 18 3.0 19 0.0 20 3.0 21 6.0 22 3.0 23 5.0 24 6.0 25 6.0 26 10.0 27 11.0 28 20.0 29 20.0 30 27.0 31 25.0 32 39.0 33 44.0 34 61.0 35 115.0 36 244.0 37 816.0 38 2008.0 39 503.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.08532249873032 15.921787709497206 17.80091416962925 38.19197562214322 2 19.81981981981982 24.824824824824827 35.41041041041041 19.944944944944947 3 23.35 27.275 26.8 22.575 4 25.8 31.95 19.575 22.675 5 23.674999999999997 35.525 22.625 18.175 6 17.349999999999998 37.3 24.625 20.724999999999998 7 16.075 17.775 44.6 21.55 8 19.45 23.225 28.225 29.099999999999998 9 19.900000000000002 24.325 30.099999999999998 25.674999999999997 10-11 22.3 34.65 21.5375 21.512500000000003 12-13 20.5875 26.650000000000002 29.7375 23.025000000000002 14-15 21.3 27.950000000000003 29.012500000000003 21.7375 16-17 22.325 27.9375 27.287499999999998 22.45 18-19 21.95 27.8875 27.525 22.6375 20-21 21.6125 28.449999999999996 27.187499999999996 22.75 22-23 21.2375 29.4125 26.924999999999997 22.425 24-25 22.175 28.549999999999997 27.0 22.275 26-27 22.1 28.575 27.650000000000002 21.675 28-29 21.325 28.3625 27.825 22.4875 30-31 20.962500000000002 27.400000000000002 28.7 22.9375 32-33 22.275 28.4125 27.0125 22.3 34-35 20.7125 29.312500000000004 27.075 22.900000000000002 36-37 21.9 28.775000000000002 27.55 21.775 38-39 21.9375 27.3375 27.85 22.875 40-41 21.7 27.712500000000002 28.4125 22.175 42-43 21.775 27.6125 28.812500000000004 21.8 44-45 21.75 27.8125 27.987499999999997 22.45 46-47 22.400000000000002 27.5125 27.9375 22.15 48-49 21.7875 27.8875 27.962500000000002 22.3625 50-51 21.375 27.5125 29.025000000000002 22.0875 52-53 21.8 28.487499999999997 27.825 21.8875 54-55 22.0 28.512500000000003 26.9125 22.575 56-57 21.7375 28.3875 28.000000000000004 21.875 58-59 21.8125 28.6875 27.5875 21.912499999999998 60-61 21.762500000000003 28.425 27.750000000000004 22.0625 62-63 22.3625 28.287499999999998 27.487499999999997 21.8625 64-65 21.275 28.299999999999997 28.599999999999998 21.825 66-67 21.912499999999998 28.275 28.125 21.6875 68-69 22.0 28.9125 27.575 21.512500000000003 70-71 20.837500000000002 28.449999999999996 28.825 21.8875 72-73 22.525000000000002 27.8375 28.050000000000004 21.587500000000002 74-75 21.425 27.725 29.4 21.45 76-77 22.412499999999998 26.9625 27.675 22.95 78-79 22.575 27.6625 27.825 21.9375 80-81 22.15 27.787499999999998 27.750000000000004 22.3125 82-83 22.2125 27.075 28.95 21.762500000000003 84-85 22.0125 28.6875 27.200000000000003 22.1 86-87 22.112499999999997 28.0625 27.625 22.2 88-89 21.4375 28.199999999999996 28.1375 22.225 90-91 21.9 27.125 28.549999999999997 22.425 92-93 21.875 28.449999999999996 27.787499999999998 21.8875 94-95 22.5125 27.9125 27.275 22.3 96-97 22.2625 28.749999999999996 27.950000000000003 21.0375 98-99 22.6375 27.725 27.8875 21.75 100 21.85 28.325 27.950000000000003 21.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 1.0 22 2.0 23 2.5 24 3.0 25 4.0 26 4.0 27 6.0 28 8.0 29 11.0 30 18.5 31 22.5 32 34.5 33 49.5 34 57.0 35 73.5 36 100.5 37 122.5 38 139.0 39 159.0 40 195.0 41 228.0 42 235.5 43 239.0 44 256.0 45 263.0 46 265.0 47 257.0 48 227.0 49 202.0 50 168.0 51 130.0 52 105.0 53 96.5 54 82.5 55 48.5 56 32.0 57 29.0 58 23.0 59 22.5 60 17.5 61 9.0 62 5.0 63 5.5 64 7.0 65 5.5 66 5.0 67 4.0 68 1.5 69 1.0 70 1.5 71 1.5 72 3.0 73 3.5 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785571 spots for SRR3207803.sra Written 785571 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra Read 785567 spots for SRR3207803.sra Written 785567 spots for SRR3207803.sra SRR ids: ['SRR3207803.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c3ho916h SRR3207803.sra spots: 15711344 blocks: [[1, 785567], [785568, 1571134], [1571135, 2356701], [2356702, 3142268], [3142269, 3927835], [3927836, 4713402], [4713403, 5498969], [5498970, 6284536], [6284537, 7070103], [7070104, 7855670], [7855671, 8641237], [8641238, 9426804], [9426805, 10212371], [10212372, 10997938], [10997939, 11783505], [11783506, 12569072], [12569073, 13354639], [13354640, 14140206], [14140207, 14925773], [14925774, 15711344]] SRR3207803 file size 4077937 SRR3207803 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207803 SRR3207803_1.fastq Input file: SRR3207803_1.fastq trimmed: SRR3207803-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 00:30:19 2025 >> started Tue Feb 11 00:30:27 2025 >> done (7.935s) 15711344 reads processed; of these: 1922 ( 0.01%) short reads filtered out after trimming by size control 18831 ( 0.12%) empty reads filtered out after trimming by size control 15690591 (99.87%) reads available; of these: 503404 ( 3.21%) trimmed reads available after processing 15187187 (96.79%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 339 0.00% 19 393 0.00% 20 483 0.00% 21 623 0.00% 22 771 0.00% 23 1026 0.01% 24 1354 0.01% 25 1750 0.01% 26 2108 0.01% 27 2238 0.01% 28 1948 0.01% 29 1909 0.01% 30 1789 0.01% 31 1851 0.01% 32 1878 0.01% 33 1827 0.01% 34 1918 0.01% 35 1871 0.01% 36 1961 0.01% 37 1908 0.01% 38 1961 0.01% 39 2022 0.01% 40 2045 0.01% 41 2091 0.01% 42 2133 0.01% 43 2395 0.02% 44 2459 0.02% 45 2526 0.02% 46 2585 0.02% 47 2693 0.02% 48 2811 0.02% 49 2771 0.02% 50 2940 0.02% 51 3046 0.02% 52 3111 0.02% 53 3033 0.02% 54 3251 0.02% 55 3177 0.02% 56 3193 0.02% 57 3237 0.02% 58 3388 0.02% 59 3504 0.02% 60 3639 0.02% 61 3514 0.02% 62 3834 0.02% 63 3659 0.02% 64 3794 0.02% 65 3811 0.02% 66 4171 0.03% 67 3987 0.03% 68 4168 0.03% 69 4416 0.03% 70 4605 0.03% 71 4685 0.03% 72 4884 0.03% 73 4888 0.03% 74 5008 0.03% 75 4988 0.03% 76 3890 0.02% 77 4441 0.03% 78 4928 0.03% 79 5094 0.03% 80 5335 0.03% 81 5714 0.04% 82 6212 0.04% 83 6885 0.04% 84 7088 0.05% 85 7218 0.05% 86 7778 0.05% 87 8359 0.05% 88 9350 0.06% 89 9711 0.06% 90 10768 0.07% 91 11991 0.08% 92 13725 0.09% 93 15698 0.10% 94 18614 0.12% 95 22986 0.15% 96 31164 0.20% 97 35945 0.23% 98 41257 0.26% 99 50885 0.32% 100 15187187 96.79% 15690591 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=7.40 fanout-score-rank=20 prefix-density=0.09 prefix-fanout=4.5 sequence=AAGAAGCTTCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=12 fanout-score=162.24 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=22.2 sequence=AAGAAGAAGAAA Started job on | Feb 11 00:30:42 Started mapping on | Feb 11 00:30:43 Finished on | Feb 11 00:30:59 Mapping speed, Million of reads per hour | 3530.38 Number of input reads | 15690591 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15028213 Uniquely mapped reads % | 95.78% Average mapped length | 99.18 Number of splices: Total | 4235598 Number of splices: Annotated (sjdb) | 4159387 Number of splices: GT/AG | 4173737 Number of splices: GC/AG | 51010 Number of splices: AT/AC | 3970 Number of splices: Non-canonical | 6881 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.02% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343029 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 241054 % of reads mapped to too many loci | 1.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 319349 319349 319349 N_multimapping 343029 343029 343029 N_noFeature 630542 7768363 7778909 N_ambiguous 161455 24511 25671 UnstrandedReadsAssigned:14236216 PositiveStrandReadsAssigned:7235339 NegativeStrandReadsAssigned:7223633 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207803 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207803-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,690,591 reads, 14,745,420 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR3207803.ke.tsv 34699 SRR3207803.se.tsv 87100 total ==> SRR3207803.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 356 18.1929 Potri.005G024800.1.v4.1 1035 936 40.0078 4.19175 Potri.004G059700.1.v4.1 961 862 9 1.02391 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 274.328 9.45948 Potri.016G087400.1.v4.1 270 171 807 462.811 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 60 3.51497 Potri.012G127500.1.v4.1 977 878 1502 167.765 ==> SRR3207803.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1670 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 288 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207803 completed mapping pipeline successfully