Starting /dee2/code/volunteer_pipeline.sh SRR3207804 current disk space = 3057407619072 free memory = 1122706828 SRR3207804 SRAfilesize cf25baa00b2480c6b3bdbb7d7280c15f SRR3207804.sra SRR3207804.sra file validated SRR3207804 is single end SRR3207804 is conventional basespace SRR3207804 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207804_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99725 34.0 33.0 34.0 31.0 34.0 2 33.2655 34.0 34.0 34.0 31.0 34.0 3 33.4965 34.0 34.0 34.0 31.0 34.0 4 36.6865 37.0 37.0 37.0 35.0 37.0 5 36.69425 37.0 37.0 37.0 35.0 37.0 6 36.6815 37.0 37.0 37.0 35.0 37.0 7 36.5535 37.0 37.0 37.0 35.0 37.0 8 36.6315 37.0 37.0 37.0 35.0 37.0 9 38.6185 39.0 39.0 39.0 38.0 39.0 10-11 38.579125 39.0 39.0 39.0 38.0 39.0 12-13 38.499125 39.0 39.0 39.0 37.5 39.0 14-15 40.174 41.0 40.0 41.0 38.5 41.0 16-17 40.175625 41.0 40.0 41.0 38.5 41.0 18-19 40.07725 41.0 40.0 41.0 38.5 41.0 20-21 40.196375 41.0 40.0 41.0 39.0 41.0 22-23 40.125625 41.0 40.0 41.0 38.5 41.0 24-25 40.005375 41.0 40.0 41.0 38.0 41.0 26-27 39.983625 41.0 40.0 41.0 38.0 41.0 28-29 39.933375 41.0 40.0 41.0 38.0 41.0 30-31 39.777125 41.0 40.0 41.0 38.0 41.0 32-33 39.767875000000004 41.0 40.0 41.0 38.0 41.0 34-35 39.790625 41.0 40.0 41.0 38.0 41.0 36-37 39.7005 41.0 40.0 41.0 38.0 41.0 38-39 39.62775 41.0 40.0 41.0 38.0 41.0 40-41 39.70075 41.0 40.0 41.0 37.5 41.0 42-43 39.71625 41.0 40.0 41.0 38.0 41.0 44-45 39.665625 41.0 40.0 41.0 37.5 41.0 46-47 39.670625 41.0 40.0 41.0 37.5 41.0 48-49 39.56925 41.0 40.0 41.0 37.0 41.0 50-51 39.423 41.0 40.0 41.0 37.0 41.0 52-53 39.386375 41.0 40.0 41.0 36.0 41.0 54-55 39.132374999999996 41.0 39.0 41.0 36.0 41.0 56-57 38.96125 41.0 39.0 41.0 35.0 41.0 58-59 38.803124999999994 41.0 39.0 41.0 35.0 41.0 60-61 38.599625 40.5 38.0 41.0 35.0 41.0 62-63 38.321250000000006 40.0 37.5 41.0 35.0 41.0 64-65 38.045375 39.5 37.0 41.0 35.0 41.0 66-67 37.67725 39.0 36.5 41.0 34.0 41.0 68-69 37.285250000000005 39.0 36.0 41.0 34.0 41.0 70-71 36.906375 37.5 35.0 40.0 34.0 41.0 72-73 36.427499999999995 37.0 35.0 39.0 33.0 41.0 74-75 35.984750000000005 37.0 35.0 39.0 33.0 40.5 76-77 35.044 36.0 34.5 37.5 31.5 39.0 78-79 34.985 36.0 35.0 37.0 32.5 39.0 80-81 34.680625 35.0 35.0 37.0 32.5 39.0 82-83 34.439750000000004 35.0 35.0 36.0 32.0 37.0 84-85 34.21825 35.0 35.0 36.0 32.0 37.0 86-87 34.000125 35.0 35.0 36.0 32.0 36.5 88-89 33.898250000000004 35.0 35.0 35.0 32.0 36.0 90-91 33.694 35.0 35.0 35.0 32.0 36.0 92-93 33.520875000000004 35.0 34.5 35.0 31.5 36.0 94-95 33.380375 35.0 34.0 35.0 31.0 36.0 96-97 33.286 35.0 34.0 35.0 31.0 35.0 98-99 33.155874999999995 35.0 34.0 35.0 31.0 35.0 100 33.008 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 2.0 12 2.0 13 5.0 14 3.0 15 5.0 16 2.0 17 1.0 18 2.0 19 5.0 20 4.0 21 7.0 22 3.0 23 7.0 24 11.0 25 8.0 26 10.0 27 15.0 28 15.0 29 21.0 30 24.0 31 20.0 32 33.0 33 42.0 34 56.0 35 108.0 36 233.0 37 791.0 38 2007.0 39 555.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.958702812262477 16.16417532303015 16.31618951102103 38.56093235368635 2 21.122525682786268 24.004009020295666 35.95590077674768 18.917564520170384 3 22.45 26.474999999999998 27.250000000000004 23.825 4 24.0 33.625 21.325 21.05 5 24.85 36.075 20.925 18.15 6 18.05 37.3 24.05 20.599999999999998 7 16.375 18.0 45.074999999999996 20.549999999999997 8 18.75 23.425 29.849999999999998 27.975 9 19.375 23.200000000000003 30.7 26.724999999999998 10-11 22.8625 34.2 21.6 21.337500000000002 12-13 20.349999999999998 26.887499999999996 30.012499999999996 22.75 14-15 21.0375 27.275 28.9 22.787499999999998 16-17 21.675 28.4375 28.475 21.4125 18-19 20.525 28.95 27.462500000000002 23.0625 20-21 21.6875 27.750000000000004 27.950000000000003 22.6125 22-23 21.975 28.050000000000004 28.4375 21.5375 24-25 21.15 29.025000000000002 28.3875 21.4375 26-27 21.4875 27.987499999999997 28.537499999999998 21.987499999999997 28-29 21.45 27.737499999999997 28.65 22.162499999999998 30-31 21.275 28.287499999999998 28.462500000000002 21.975 32-33 22.025 27.975 28.625 21.375 34-35 21.912499999999998 27.875 28.0875 22.125 36-37 20.974999999999998 28.449999999999996 27.962500000000002 22.6125 38-39 20.9 28.8625 27.474999999999998 22.7625 40-41 22.162499999999998 28.4125 27.8625 21.5625 42-43 22.237499999999997 28.762500000000003 27.375 21.625 44-45 21.087500000000002 29.512500000000003 27.125 22.275 46-47 21.5625 28.1625 27.825 22.45 48-49 20.65 28.249999999999996 28.3375 22.7625 50-51 22.225 27.0625 28.1625 22.55 52-53 22.125 28.1875 27.474999999999998 22.2125 54-55 21.9625 27.987499999999997 26.8375 23.2125 56-57 21.6875 28.425 28.075 21.8125 58-59 22.0125 27.737499999999997 28.237499999999997 22.0125 60-61 21.7375 28.475 28.1375 21.65 62-63 21.15 28.549999999999997 27.9375 22.3625 64-65 21.8875 28.6875 28.8375 20.5875 66-67 22.175 27.675 27.8375 22.3125 68-69 21.625 28.4375 27.450000000000003 22.4875 70-71 21.2375 29.062500000000004 28.012500000000003 21.6875 72-73 20.95 28.000000000000004 28.4375 22.6125 74-75 21.3625 27.800000000000004 28.000000000000004 22.8375 76-77 21.9625 27.537499999999998 28.499999999999996 22.0 78-79 22.425 29.0875 26.887499999999996 21.6 80-81 22.162499999999998 27.675 28.249999999999996 21.912499999999998 82-83 21.587500000000002 28.4375 28.525 21.45 84-85 21.675 27.237499999999997 28.525 22.5625 86-87 21.349999999999998 28.275 27.537499999999998 22.8375 88-89 22.0 28.712500000000002 27.075 22.2125 90-91 21.875 28.1 28.3875 21.637500000000003 92-93 22.1875 28.7375 27.650000000000002 21.425 94-95 21.987499999999997 29.025000000000002 28.0875 20.9 96-97 21.6875 27.3875 28.775000000000002 22.15 98-99 22.575 28.6125 27.325 21.4875 100 22.325 27.875 28.499999999999996 21.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 2.0 20 2.0 21 0.5 22 1.0 23 1.5 24 3.5 25 5.0 26 4.0 27 6.0 28 8.5 29 12.0 30 20.0 31 24.0 32 35.0 33 43.5 34 55.5 35 71.0 36 90.0 37 117.0 38 147.0 39 170.0 40 195.5 41 210.0 42 238.5 43 268.0 44 271.5 45 279.0 46 277.0 47 264.0 48 223.5 49 201.5 50 176.5 51 130.5 52 103.0 53 80.0 54 59.0 55 45.0 56 37.5 57 30.5 58 20.5 59 14.0 60 10.0 61 7.5 62 6.5 63 5.5 64 5.5 65 3.5 66 1.0 67 1.5 68 3.0 69 3.0 70 1.0 71 0.5 72 0.5 73 0.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra Read 657530 spots for SRR3207804.sra Written 657530 spots for SRR3207804.sra Read 657523 spots for SRR3207804.sra Written 657523 spots for SRR3207804.sra SRR ids: ['SRR3207804.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_400z65vb SRR3207804.sra spots: 13150467 blocks: [[1, 657523], [657524, 1315046], [1315047, 1972569], [1972570, 2630092], [2630093, 3287615], [3287616, 3945138], [3945139, 4602661], [4602662, 5260184], [5260185, 5917707], [5917708, 6575230], [6575231, 7232753], [7232754, 7890276], [7890277, 8547799], [8547800, 9205322], [9205323, 9862845], [9862846, 10520368], [10520369, 11177891], [11177892, 11835414], [11835415, 12492937], [12492938, 13150467]] SRR3207804 file size 3411485 SRR3207804 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207804 SRR3207804_1.fastq Input file: SRR3207804_1.fastq trimmed: SRR3207804-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 23:52:36 2025 >> started Mon Feb 10 23:52:44 2025 >> done (8.175s) 13150467 reads processed; of these: 1898 ( 0.01%) short reads filtered out after trimming by size control 16679 ( 0.13%) empty reads filtered out after trimming by size control 13131890 (99.86%) reads available; of these: 415712 ( 3.17%) trimmed reads available after processing 12716178 (96.83%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 271 0.00% 19 299 0.00% 20 403 0.00% 21 478 0.00% 22 593 0.00% 23 856 0.01% 24 1132 0.01% 25 1299 0.01% 26 1788 0.01% 27 2041 0.02% 28 1670 0.01% 29 1680 0.01% 30 1498 0.01% 31 1530 0.01% 32 1493 0.01% 33 1433 0.01% 34 1452 0.01% 35 1472 0.01% 36 1532 0.01% 37 1580 0.01% 38 1537 0.01% 39 1638 0.01% 40 1673 0.01% 41 1679 0.01% 42 1769 0.01% 43 1848 0.01% 44 2004 0.02% 45 2063 0.02% 46 2119 0.02% 47 2083 0.02% 48 2151 0.02% 49 2285 0.02% 50 2391 0.02% 51 2481 0.02% 52 2604 0.02% 53 2485 0.02% 54 2573 0.02% 55 2527 0.02% 56 2711 0.02% 57 2742 0.02% 58 2793 0.02% 59 2779 0.02% 60 2873 0.02% 61 2871 0.02% 62 3081 0.02% 63 3022 0.02% 64 3115 0.02% 65 3093 0.02% 66 3283 0.03% 67 3457 0.03% 68 3547 0.03% 69 3562 0.03% 70 3711 0.03% 71 3808 0.03% 72 4073 0.03% 73 4055 0.03% 74 4092 0.03% 75 4195 0.03% 76 3138 0.02% 77 3679 0.03% 78 4075 0.03% 79 4148 0.03% 80 4521 0.03% 81 4783 0.04% 82 5265 0.04% 83 5557 0.04% 84 5865 0.04% 85 6012 0.05% 86 6300 0.05% 87 6922 0.05% 88 7620 0.06% 89 8104 0.06% 90 8877 0.07% 91 10024 0.08% 92 11418 0.09% 93 13082 0.10% 94 15685 0.12% 95 18994 0.14% 96 25672 0.20% 97 29773 0.23% 98 34643 0.26% 99 42282 0.32% 100 12716178 96.83% 13131890 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=8.42 fanout-score-rank=12 prefix-density=0.09 prefix-fanout=5.0 sequence=AAGAAGCTTCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=8 fanout-score=163.71 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=22.4 sequence=AAGAAGAAGAAA Started job on | Feb 10 23:53:03 Started mapping on | Feb 10 23:53:03 Finished on | Feb 10 23:53:16 Mapping speed, Million of reads per hour | 3636.52 Number of input reads | 13131890 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 12634866 Uniquely mapped reads % | 96.22% Average mapped length | 99.19 Number of splices: Total | 3695655 Number of splices: Annotated (sjdb) | 3628177 Number of splices: GT/AG | 3640887 Number of splices: GC/AG | 44672 Number of splices: AT/AC | 3823 Number of splices: Non-canonical | 6273 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286502 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 121755 % of reads mapped to too many loci | 0.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 210522 210522 210522 N_multimapping 286502 286502 286502 N_noFeature 547620 6532238 6556239 N_ambiguous 138026 22054 22159 UnstrandedReadsAssigned:11949220 PositiveStrandReadsAssigned:6080574 NegativeStrandReadsAssigned:6056468 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207804 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207804-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,131,890 reads, 12,321,430 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR3207804.ke.tsv 34699 SRR3207804.se.tsv 87100 total ==> SRR3207804.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 312 20.2883 Potri.005G024800.1.v4.1 1035 936 25 3.33296 Potri.004G059700.1.v4.1 961 862 19 2.75051 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 232.146 10.1859 Potri.016G087400.1.v4.1 270 171 522 380.926 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 74 5.51623 Potri.012G127500.1.v4.1 977 878 849 120.664 ==> SRR3207804.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1613 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 232 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 44 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207804 completed mapping pipeline successfully