Starting /dee2/code/volunteer_pipeline.sh SRR3207805 current disk space = 3057401585664 free memory = 1319947804 SRR3207805 SRAfilesize babee7492b6213362fb244abad471e0f SRR3207805.sra SRR3207805.sra file validated SRR3207805 is single end SRR3207805 is conventional basespace SRR3207805 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207805_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05175 34.0 34.0 34.0 31.0 34.0 2 33.2695 34.0 34.0 34.0 31.0 34.0 3 33.5045 34.0 34.0 34.0 31.0 34.0 4 36.71675 37.0 37.0 37.0 35.0 37.0 5 36.71425 37.0 37.0 37.0 35.0 37.0 6 36.70375 37.0 37.0 37.0 35.0 37.0 7 36.64025 37.0 37.0 37.0 35.0 37.0 8 36.6685 37.0 37.0 37.0 35.0 37.0 9 38.6535 39.0 39.0 39.0 38.0 39.0 10-11 38.595625 39.0 39.0 39.0 38.0 39.0 12-13 38.578875 39.0 39.0 39.0 38.0 39.0 14-15 40.260625000000005 41.0 40.0 41.0 39.0 41.0 16-17 40.274125 41.0 40.0 41.0 38.5 41.0 18-19 40.20875 41.0 40.0 41.0 38.5 41.0 20-21 40.238375 41.0 40.0 41.0 39.0 41.0 22-23 40.20075 41.0 40.0 41.0 39.0 41.0 24-25 40.083375000000004 41.0 40.0 41.0 38.0 41.0 26-27 40.033375 41.0 40.0 41.0 38.0 41.0 28-29 40.005624999999995 41.0 40.0 41.0 38.0 41.0 30-31 39.863375000000005 41.0 40.0 41.0 38.0 41.0 32-33 39.8625 41.0 40.0 41.0 38.0 41.0 34-35 39.8935 41.0 40.0 41.0 38.0 41.0 36-37 39.740875 41.0 40.0 41.0 38.0 41.0 38-39 39.667874999999995 41.0 40.0 41.0 37.5 41.0 40-41 39.678625 41.0 40.0 41.0 37.5 41.0 42-43 39.849875 41.0 40.0 41.0 38.0 41.0 44-45 39.78975 41.0 40.0 41.0 38.0 41.0 46-47 39.717124999999996 41.0 40.0 41.0 37.5 41.0 48-49 39.6785 41.0 40.0 41.0 37.5 41.0 50-51 39.56725 41.0 40.0 41.0 37.0 41.0 52-53 39.46875 41.0 40.0 41.0 37.0 41.0 54-55 39.249624999999995 41.0 39.0 41.0 36.0 41.0 56-57 39.091125000000005 41.0 39.0 41.0 35.5 41.0 58-59 38.903375 41.0 39.0 41.0 35.0 41.0 60-61 38.759625 40.5 38.0 41.0 35.0 41.0 62-63 38.436125000000004 40.0 37.5 41.0 35.0 41.0 64-65 38.163125 39.5 37.0 41.0 35.0 41.0 66-67 37.7625 39.0 36.5 41.0 34.0 41.0 68-69 37.388125 39.0 36.0 41.0 34.0 41.0 70-71 36.933875 37.5 35.5 40.0 34.0 41.0 72-73 36.499125 37.0 35.0 39.0 34.0 41.0 74-75 35.968625 36.5 35.0 39.0 33.0 40.5 76-77 35.048 35.5 34.5 37.0 32.0 39.0 78-79 35.054500000000004 35.5 35.0 37.0 32.5 39.0 80-81 34.774125 35.0 35.0 37.0 33.0 38.5 82-83 34.568375 35.0 35.0 36.0 33.0 37.0 84-85 34.28 35.0 35.0 36.0 33.0 37.0 86-87 34.03037500000001 35.0 35.0 36.0 32.0 36.5 88-89 33.897375 35.0 35.0 35.0 32.0 36.0 90-91 33.773875000000004 35.0 35.0 35.0 32.0 36.0 92-93 33.632999999999996 35.0 34.5 35.0 32.0 36.0 94-95 33.472 35.0 34.0 35.0 32.0 36.0 96-97 33.419875000000005 35.0 34.0 35.0 31.5 35.0 98-99 33.200374999999994 35.0 34.0 35.0 31.0 35.0 100 33.1015 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 6.0 14 5.0 15 1.0 16 3.0 17 2.0 18 1.0 19 5.0 20 4.0 21 2.0 22 6.0 23 1.0 24 11.0 25 6.0 26 12.0 27 8.0 28 12.0 29 13.0 30 18.0 31 27.0 32 43.0 33 43.0 34 63.0 35 106.0 36 228.0 37 849.0 38 2015.0 39 508.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.151898734177212 15.417721518987342 16.075949367088608 38.35443037974684 2 19.654481722583874 23.73560340510766 37.70655983975964 18.903355032548824 3 23.125 26.85 27.700000000000003 22.325 4 24.975 33.650000000000006 20.1 21.275 5 24.4 35.75 21.875 17.974999999999998 6 18.5 38.4 22.5 20.599999999999998 7 16.0 18.0 44.824999999999996 21.175 8 18.6 22.875 29.225 29.299999999999997 9 20.075000000000003 23.025000000000002 30.725 26.174999999999997 10-11 22.475 33.6625 22.8125 21.05 12-13 20.175 26.4625 30.2 23.1625 14-15 21.125 28.037499999999998 28.9 21.9375 16-17 21.025 28.237499999999997 28.3125 22.425 18-19 21.625 29.2875 27.474999999999998 21.6125 20-21 21.212500000000002 29.15 27.287499999999998 22.35 22-23 22.025 28.475 27.275 22.225 24-25 21.462500000000002 28.275 27.925 22.3375 26-27 21.275 28.6375 28.1875 21.9 28-29 21.375 29.4125 27.55 21.6625 30-31 22.05 28.299999999999997 27.55 22.1 32-33 22.75 28.225 27.675 21.349999999999998 34-35 22.900000000000002 27.35 27.0125 22.7375 36-37 22.2125 27.6375 28.537499999999998 21.6125 38-39 21.975 27.737499999999997 28.9 21.3875 40-41 21.7375 27.5875 29.075 21.6 42-43 21.6 27.650000000000002 28.525 22.225 44-45 21.6875 28.037499999999998 28.6625 21.6125 46-47 21.9625 27.900000000000002 28.050000000000004 22.0875 48-49 21.8 28.575 27.474999999999998 22.15 50-51 22.525000000000002 28.599999999999998 26.8 22.075 52-53 22.1375 27.9125 27.6625 22.287499999999998 54-55 22.025 27.55 28.050000000000004 22.375 56-57 21.275 26.974999999999998 29.4 22.35 58-59 21.975 28.4125 27.900000000000002 21.712500000000002 60-61 21.099999999999998 28.3875 28.499999999999996 22.0125 62-63 22.325 28.5625 27.875 21.2375 64-65 22.525000000000002 27.8625 27.5125 22.1 66-67 22.3625 27.250000000000004 28.3875 22.0 68-69 22.4625 28.799999999999997 27.325 21.4125 70-71 22.2625 29.125 26.8625 21.75 72-73 22.275 28.749999999999996 27.6875 21.2875 74-75 20.962500000000002 28.65 27.5875 22.8 76-77 22.2625 28.275 27.987499999999997 21.475 78-79 21.975 28.4 28.050000000000004 21.575 80-81 21.85 28.725 28.1 21.325 82-83 22.0 27.437499999999996 28.249999999999996 22.3125 84-85 22.3875 28.3875 27.35 21.875 86-87 22.1875 27.375 29.012500000000003 21.425 88-89 22.5125 29.125 27.487499999999997 20.875 90-91 22.1875 27.5125 28.8625 21.4375 92-93 21.712500000000002 28.5625 27.8875 21.837500000000002 94-95 22.537499999999998 28.1625 27.487499999999997 21.8125 96-97 21.925 27.962500000000002 28.175 21.9375 98-99 21.9 29.1375 27.375 21.587500000000002 100 23.1 27.6 27.200000000000003 22.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 2.0 24 1.0 25 1.0 26 2.0 27 5.0 28 13.0 29 17.5 30 20.5 31 29.0 32 33.0 33 39.5 34 54.0 35 75.5 36 95.0 37 109.5 38 138.0 39 169.0 40 202.5 41 226.0 42 227.0 43 248.5 44 283.5 45 275.5 46 272.5 47 274.0 48 227.0 49 183.0 50 164.0 51 140.0 52 114.0 53 92.0 54 65.5 55 44.0 56 33.5 57 24.5 58 15.5 59 16.0 60 12.5 61 8.0 62 8.0 63 7.0 64 4.0 65 3.5 66 3.5 67 2.0 68 3.0 69 2.0 70 0.5 71 0.5 72 1.0 73 1.5 74 1.0 75 0.5 76 0.0 77 0.5 78 1.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.1125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685485 spots for SRR3207805.sra Written 685485 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra Read 685480 spots for SRR3207805.sra Written 685480 spots for SRR3207805.sra SRR ids: ['SRR3207805.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qc3xelcf SRR3207805.sra spots: 13709605 blocks: [[1, 685480], [685481, 1370960], [1370961, 2056440], [2056441, 2741920], [2741921, 3427400], [3427401, 4112880], [4112881, 4798360], [4798361, 5483840], [5483841, 6169320], [6169321, 6854800], [6854801, 7540280], [7540281, 8225760], [8225761, 8911240], [8911241, 9596720], [9596721, 10282200], [10282201, 10967680], [10967681, 11653160], [11653161, 12338640], [12338641, 13024120], [13024121, 13709605]] SRR3207805 file size 3556988 SRR3207805 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207805 SRR3207805_1.fastq Input file: SRR3207805_1.fastq trimmed: SRR3207805-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 00:00:25 2025 >> started Tue Feb 11 00:00:32 2025 >> done (7.478s) 13709605 reads processed; of these: 1668 ( 0.01%) short reads filtered out after trimming by size control 15954 ( 0.12%) empty reads filtered out after trimming by size control 13691983 (99.87%) reads available; of these: 413287 ( 3.02%) trimmed reads available after processing 13278696 (96.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 212 0.00% 19 270 0.00% 20 340 0.00% 21 463 0.00% 22 604 0.00% 23 846 0.01% 24 1088 0.01% 25 1368 0.01% 26 1650 0.01% 27 1870 0.01% 28 1590 0.01% 29 1607 0.01% 30 1489 0.01% 31 1430 0.01% 32 1471 0.01% 33 1431 0.01% 34 1457 0.01% 35 1555 0.01% 36 1493 0.01% 37 1487 0.01% 38 1539 0.01% 39 1536 0.01% 40 1573 0.01% 41 1610 0.01% 42 1678 0.01% 43 1818 0.01% 44 1823 0.01% 45 1929 0.01% 46 2090 0.02% 47 2123 0.02% 48 2079 0.02% 49 2321 0.02% 50 2166 0.02% 51 2519 0.02% 52 2366 0.02% 53 2545 0.02% 54 2535 0.02% 55 2512 0.02% 56 2550 0.02% 57 2692 0.02% 58 2720 0.02% 59 2786 0.02% 60 2804 0.02% 61 2827 0.02% 62 2940 0.02% 63 2963 0.02% 64 3120 0.02% 65 3115 0.02% 66 3422 0.02% 67 3227 0.02% 68 3410 0.02% 69 3626 0.03% 70 3679 0.03% 71 3762 0.03% 72 3856 0.03% 73 3996 0.03% 74 4106 0.03% 75 4088 0.03% 76 3214 0.02% 77 3775 0.03% 78 3962 0.03% 79 4205 0.03% 80 4407 0.03% 81 4596 0.03% 82 5039 0.04% 83 5465 0.04% 84 5880 0.04% 85 6023 0.04% 86 6316 0.05% 87 6725 0.05% 88 7739 0.06% 89 8112 0.06% 90 9049 0.07% 91 9965 0.07% 92 11096 0.08% 93 12933 0.09% 94 15530 0.11% 95 19006 0.14% 96 26155 0.19% 97 30284 0.22% 98 34788 0.25% 99 42851 0.31% 100 13278696 96.98% 13691983 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=11.27 fanout-score-rank=8 prefix-density=0.10 prefix-fanout=5.8 sequence=AAGAAGCTTCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=12 fanout-score=277.42 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=28.7 sequence=TTCTTCTTCTTT Started job on | Feb 11 00:00:48 Started mapping on | Feb 11 00:00:48 Finished on | Feb 11 00:01:03 Mapping speed, Million of reads per hour | 3286.08 Number of input reads | 13691983 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 13187431 Uniquely mapped reads % | 96.31% Average mapped length | 99.22 Number of splices: Total | 3941218 Number of splices: Annotated (sjdb) | 3872850 Number of splices: GT/AG | 3883133 Number of splices: GC/AG | 48265 Number of splices: AT/AC | 3720 Number of splices: Non-canonical | 6100 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.02% Deletion average length | 1.97 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297930 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 138977 % of reads mapped to too many loci | 1.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 206622 206622 206622 N_multimapping 297930 297930 297930 N_noFeature 543758 6806315 6837516 N_ambiguous 130593 21244 22184 UnstrandedReadsAssigned:12513080 PositiveStrandReadsAssigned:6359872 NegativeStrandReadsAssigned:6327731 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207805 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207805-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,691,983 reads, 12,896,278 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52401 SRR3207805.ke.tsv 34699 SRR3207805.se.tsv 87100 total ==> SRR3207805.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 309 18.7003 Potri.005G024800.1.v4.1 1035 936 26 3.22599 Potri.004G059700.1.v4.1 961 862 6 0.808368 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 217.454 8.87978 Potri.016G087400.1.v4.1 270 171 546 370.819 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 40 2.77504 Potri.012G127500.1.v4.1 977 878 1484 196.293 ==> SRR3207805.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1378 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 203 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 33 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207805 completed mapping pipeline successfully