Starting /dee2/code/volunteer_pipeline.sh SRR3207806 current disk space = 3057178202112 free memory = 1578854416 SRR3207806 SRAfilesize 200150ef66fe601fcabf1b3a088be6b8 SRR3207806.sra SRR3207806.sra file validated SRR3207806 is single end SRR3207806 is conventional basespace SRR3207806 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207806_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.58425 34.0 33.0 34.0 31.0 34.0 2 33.05625 34.0 34.0 34.0 31.0 34.0 3 33.4 34.0 34.0 34.0 31.0 34.0 4 36.66375 37.0 37.0 37.0 35.0 37.0 5 36.60175 37.0 37.0 37.0 35.0 37.0 6 36.655 37.0 37.0 37.0 35.0 37.0 7 36.61025 37.0 37.0 37.0 35.0 37.0 8 36.63625 37.0 37.0 37.0 35.0 37.0 9 38.41475 39.0 39.0 39.0 37.0 39.0 10-11 38.573499999999996 39.0 39.0 39.0 38.0 39.0 12-13 38.55575 39.0 39.0 39.0 37.0 39.0 14-15 40.178875000000005 41.0 40.0 41.0 38.0 41.0 16-17 40.110125 41.0 40.0 41.0 38.0 41.0 18-19 40.086375000000004 41.0 40.0 41.0 38.0 41.0 20-21 40.12325 41.0 40.0 41.0 38.0 41.0 22-23 40.0415 41.0 40.0 41.0 38.0 41.0 24-25 40.052625 41.0 40.0 41.0 38.0 41.0 26-27 39.936 41.0 40.0 41.0 38.0 41.0 28-29 39.835750000000004 41.0 40.0 41.0 38.0 41.0 30-31 39.63275 41.0 40.0 41.0 37.5 41.0 32-33 39.522000000000006 41.0 40.0 41.0 37.0 41.0 34-35 39.22725 40.5 39.5 41.0 36.5 41.0 36-37 39.169624999999996 40.0 39.0 41.0 36.0 41.0 38-39 39.364000000000004 41.0 39.0 41.0 37.0 41.0 40-41 39.245999999999995 41.0 39.0 41.0 36.0 41.0 42-43 39.24325 41.0 39.0 41.0 36.0 41.0 44-45 39.0105 40.5 39.0 41.0 36.0 41.0 46-47 39.079750000000004 40.5 39.0 41.0 36.0 41.0 48-49 39.276875000000004 41.0 39.0 41.0 36.5 41.0 50-51 39.292 41.0 40.0 41.0 36.5 41.0 52-53 39.048249999999996 41.0 39.0 41.0 35.5 41.0 54-55 38.83225 41.0 39.0 41.0 35.0 41.0 56-57 38.678625 41.0 38.5 41.0 35.0 41.0 58-59 38.568 40.0 38.5 41.0 35.0 41.0 60-61 38.39525 40.0 38.0 41.0 35.0 41.0 62-63 38.089749999999995 40.0 37.0 41.0 34.0 41.0 64-65 37.818375 39.5 37.0 41.0 34.0 41.0 66-67 37.40325 39.0 36.0 41.0 34.0 41.0 68-69 36.994749999999996 39.0 35.5 40.5 33.0 41.0 70-71 36.462500000000006 37.5 35.0 39.5 33.0 41.0 72-73 36.114999999999995 37.0 35.0 39.0 33.0 41.0 74-75 35.559 36.5 35.0 39.0 32.0 40.5 76-77 34.500625 35.5 34.0 37.0 30.5 39.0 78-79 34.47825 35.5 34.0 37.0 31.0 39.0 80-81 34.208875000000006 35.0 34.5 37.0 30.5 38.5 82-83 33.941125 35.0 34.0 36.0 31.0 37.0 84-85 33.720749999999995 35.0 34.0 36.0 31.0 37.0 86-87 33.505875 35.0 34.0 35.5 31.0 36.5 88-89 33.161625 35.0 34.0 35.0 30.0 36.0 90-91 32.8825 35.0 34.0 35.0 30.0 36.0 92-93 32.73325 35.0 34.0 35.0 29.0 36.0 94-95 32.571375 35.0 34.0 35.0 29.0 35.5 96-97 32.180499999999995 35.0 33.5 35.0 28.0 35.0 98-99 31.501125000000002 35.0 32.5 35.0 25.5 35.0 100 31.12675 35.0 33.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 1.0 11 1.0 12 5.0 13 1.0 14 5.0 15 3.0 16 4.0 17 4.0 18 10.0 19 3.0 20 11.0 21 8.0 22 8.0 23 8.0 24 4.0 25 14.0 26 12.0 27 10.0 28 17.0 29 22.0 30 31.0 31 35.0 32 49.0 33 78.0 34 95.0 35 157.0 36 314.0 37 866.0 38 1779.0 39 442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.95511669658887 14.92690433444473 17.158245704026672 42.95973326493973 2 18.2 23.974999999999998 38.775 19.05 3 21.15 26.674999999999997 28.575 23.599999999999998 4 25.4 32.525 19.45 22.625 5 24.287143571785894 36.643321660830416 21.785892946473236 17.283641820910457 6 17.675 37.724999999999994 24.4 20.200000000000003 7 15.875 18.875 43.575 21.675 8 19.425 23.875 29.175 27.525 9 20.075000000000003 23.525 31.874999999999996 24.525 10-11 22.575 33.900000000000006 22.35 21.175 12-13 20.05 26.700000000000003 30.049999999999997 23.200000000000003 14-15 20.6875 28.000000000000004 28.712500000000002 22.6 16-17 21.140142517814727 27.790973871733964 28.178522315289413 22.890361295161895 18-19 21.075 28.475 28.025 22.425 20-21 21.7375 28.6875 27.8625 21.712500000000002 22-23 21.3125 29.5875 27.8625 21.2375 24-25 21.212500000000002 29.1625 27.700000000000003 21.925 26-27 20.1375 28.225 28.95 22.6875 28-29 21.275 27.9125 28.199999999999996 22.6125 30-31 21.7875 29.175 27.212500000000002 21.825 32-33 22.375 29.3375 26.424999999999997 21.8625 34-35 21.349999999999998 29.2875 27.150000000000002 22.2125 36-37 21.4 28.6375 27.9375 22.025 38-39 21.8875 28.487499999999997 28.325 21.3 40-41 21.837500000000002 28.537499999999998 27.762500000000003 21.8625 42-43 21.075 28.6875 28.749999999999996 21.4875 44-45 21.675 28.575 27.8375 21.912499999999998 46-47 21.825 27.6375 28.299999999999997 22.237499999999997 48-49 21.625 28.1875 28.1875 22.0 50-51 21.8875 28.1 27.287499999999998 22.725 52-53 21.2625 28.525 27.6625 22.55 54-55 21.2625 27.675 28.1625 22.900000000000002 56-57 21.4875 28.812500000000004 28.012500000000003 21.6875 58-59 21.512500000000003 29.025000000000002 27.275 22.1875 60-61 21.45 29.375 27.5125 21.6625 62-63 22.525000000000002 27.987499999999997 27.2625 22.225 64-65 21.3 29.037499999999998 27.075 22.5875 66-67 21.425 28.537499999999998 27.875 22.162499999999998 68-69 22.275 27.712500000000002 28.025 21.987499999999997 70-71 22.475 27.4125 28.262500000000003 21.85 72-73 21.875 27.987499999999997 28.125 22.0125 74-75 22.125 27.250000000000004 28.975 21.65 76-77 22.05 28.1 27.5625 22.287499999999998 78-79 21.349999999999998 28.999999999999996 27.3125 22.3375 80-81 21.975 28.599999999999998 27.250000000000004 22.175 82-83 21.2375 28.549999999999997 28.6125 21.6 84-85 22.037499999999998 28.6625 27.212500000000002 22.0875 86-87 22.325 28.812500000000004 27.400000000000002 21.462500000000002 88-89 23.3625 27.375 28.0625 21.2 90-91 21.4875 28.1875 27.625 22.7 92-93 21.65 27.9375 28.125 22.287499999999998 94-95 22.475 28.487499999999997 27.750000000000004 21.2875 96-97 21.85 27.962500000000002 28.9875 21.2 98-99 22.6875 28.525 26.950000000000003 21.837500000000002 100 21.825 28.249999999999996 28.15 21.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 2.5 25 3.0 26 4.5 27 6.5 28 10.5 29 16.5 30 21.5 31 29.5 32 42.0 33 53.0 34 62.5 35 74.0 36 90.0 37 122.0 38 142.5 39 162.5 40 195.5 41 218.0 42 253.0 43 284.0 44 287.0 45 267.0 46 246.0 47 245.0 48 222.5 49 176.0 50 144.5 51 127.5 52 108.0 53 90.0 54 75.0 55 52.5 56 33.5 57 26.5 58 22.0 59 12.5 60 11.0 61 11.5 62 7.0 63 4.0 64 4.0 65 3.0 66 2.0 67 2.5 68 2.5 69 3.0 70 3.0 71 1.0 72 0.5 73 0.5 74 1.5 75 2.5 76 1.0 77 1.0 78 1.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5250000000000004 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88 0.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890418 spots for SRR3207806.sra Written 890418 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra Read 890416 spots for SRR3207806.sra Written 890416 spots for SRR3207806.sra SRR ids: ['SRR3207806.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y5v62d2s SRR3207806.sra spots: 17808322 blocks: [[1, 890416], [890417, 1780832], [1780833, 2671248], [2671249, 3561664], [3561665, 4452080], [4452081, 5342496], [5342497, 6232912], [6232913, 7123328], [7123329, 8013744], [8013745, 8904160], [8904161, 9794576], [9794577, 10684992], [10684993, 11575408], [11575409, 12465824], [12465825, 13356240], [13356241, 14246656], [14246657, 15137072], [15137073, 16027488], [16027489, 16917904], [16917905, 17808322]] SRR3207806 file size 4623661 SRR3207806 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207806 SRR3207806_1.fastq Input file: SRR3207806_1.fastq trimmed: SRR3207806-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 01:07:29 2025 >> started Tue Feb 11 01:07:38 2025 >> done (9.062s) 17808322 reads processed; of these: 2098 ( 0.01%) short reads filtered out after trimming by size control 5183 ( 0.03%) empty reads filtered out after trimming by size control 17801041 (99.96%) reads available; of these: 3422978 (19.23%) trimmed reads available after processing 14378063 (80.77%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 340 0.00% 19 425 0.00% 20 542 0.00% 21 727 0.00% 22 1019 0.01% 23 1439 0.01% 24 1825 0.01% 25 2459 0.01% 26 2488 0.01% 27 2547 0.01% 28 2483 0.01% 29 2522 0.01% 30 2622 0.01% 31 2646 0.01% 32 2752 0.02% 33 2762 0.02% 34 2977 0.02% 35 3157 0.02% 36 3148 0.02% 37 3278 0.02% 38 3337 0.02% 39 3318 0.02% 40 3299 0.02% 41 3330 0.02% 42 3633 0.02% 43 3586 0.02% 44 3699 0.02% 45 3703 0.02% 46 4010 0.02% 47 3747 0.02% 48 3893 0.02% 49 4147 0.02% 50 4280 0.02% 51 4568 0.03% 52 4687 0.03% 53 5187 0.03% 54 4810 0.03% 55 5070 0.03% 56 5186 0.03% 57 5438 0.03% 58 5626 0.03% 59 5819 0.03% 60 5853 0.03% 61 6171 0.03% 62 6242 0.04% 63 6380 0.04% 64 6613 0.04% 65 6952 0.04% 66 7432 0.04% 67 7692 0.04% 68 8071 0.05% 69 7738 0.04% 70 8336 0.05% 71 8404 0.05% 72 8834 0.05% 73 9503 0.05% 74 9556 0.05% 75 9856 0.06% 76 7140 0.04% 77 8271 0.05% 78 9592 0.05% 79 10676 0.06% 80 11554 0.06% 81 12522 0.07% 82 13844 0.08% 83 15973 0.09% 84 17094 0.10% 85 19385 0.11% 86 23063 0.13% 87 29290 0.16% 88 41060 0.23% 89 87862 0.49% 90 316325 1.78% 91 125017 0.70% 92 514711 2.89% 93 110268 0.62% 94 306133 1.72% 95 175403 0.99% 96 483731 2.72% 97 162116 0.91% 98 446262 2.51% 99 215522 1.21% 100 14378063 80.77% 17801041 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=55.04 fanout-score-rank=8 prefix-density=0.68 prefix-fanout=37.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=12 fanout-score=236.29 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=26.2 sequence=TTCTTCTTCTTT Started job on | Feb 11 01:07:54 Started mapping on | Feb 11 01:07:54 Finished on | Feb 11 01:08:14 Mapping speed, Million of reads per hour | 3204.19 Number of input reads | 17801041 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 17105995 Uniquely mapped reads % | 96.10% Average mapped length | 97.88 Number of splices: Total | 4780015 Number of splices: Annotated (sjdb) | 4689500 Number of splices: GT/AG | 4709378 Number of splices: GC/AG | 57541 Number of splices: AT/AC | 4515 Number of splices: Non-canonical | 8581 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.08 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 397265 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 205391 % of reads mapped to too many loci | 1.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 297781 297781 297781 N_multimapping 397265 397265 397265 N_noFeature 748905 8860241 8870016 N_ambiguous 182469 28594 29507 UnstrandedReadsAssigned:16174621 PositiveStrandReadsAssigned:8217160 NegativeStrandReadsAssigned:8206472 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207806 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207806-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,801,041 reads, 16,693,875 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,267 rounds 52401 SRR3207806.ke.tsv 34699 SRR3207806.se.tsv 87100 total ==> SRR3207806.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 452 20.9706 Potri.005G024800.1.v4.1 1035 936 50 4.756 Potri.004G059700.1.v4.1 961 862 17 1.75586 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 260.503 8.15514 Potri.016G087400.1.v4.1 270 171 882.61 459.537 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 71.6251 3.80941 Potri.012G127500.1.v4.1 977 878 1362 138.112 ==> SRR3207806.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1988 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 334 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 39 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207806 completed mapping pipeline successfully