Starting /dee2/code/volunteer_pipeline.sh SRR3207807 current disk space = 3057206046720 free memory = 1505502716 SRR3207807 SRAfilesize b62f5ee4d1eb66287e6670cff6d190fc SRR3207807.sra SRR3207807.sra file validated SRR3207807 is single end SRR3207807 is conventional basespace SRR3207807 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207807_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.643 34.0 33.0 34.0 31.0 34.0 2 32.5765 34.0 34.0 34.0 31.0 34.0 3 33.19 34.0 34.0 34.0 31.0 34.0 4 36.61825 37.0 37.0 37.0 35.0 37.0 5 36.53525 37.0 37.0 37.0 35.0 37.0 6 36.66225 37.0 37.0 37.0 35.0 37.0 7 36.618 37.0 37.0 37.0 35.0 37.0 8 36.62 37.0 37.0 37.0 35.0 37.0 9 38.4555 39.0 39.0 39.0 37.0 39.0 10-11 38.561875 39.0 39.0 39.0 37.5 39.0 12-13 38.52825 39.0 39.0 39.0 37.0 39.0 14-15 40.17075 41.0 40.0 41.0 38.0 41.0 16-17 40.08525 41.0 40.0 41.0 38.0 41.0 18-19 40.025625 41.0 40.0 41.0 38.0 41.0 20-21 40.04925 41.0 40.0 41.0 38.0 41.0 22-23 40.001374999999996 41.0 40.0 41.0 38.0 41.0 24-25 39.997125 41.0 40.0 41.0 38.0 41.0 26-27 39.889375 41.0 40.0 41.0 38.0 41.0 28-29 39.7765 41.0 40.0 41.0 38.0 41.0 30-31 39.607625 41.0 40.0 41.0 37.0 41.0 32-33 39.5815 41.0 40.0 41.0 37.0 41.0 34-35 39.311625 40.5 39.5 41.0 36.5 41.0 36-37 39.172375 40.0 39.0 41.0 36.0 41.0 38-39 39.32025 41.0 39.0 41.0 36.5 41.0 40-41 39.321375 41.0 39.0 41.0 37.0 41.0 42-43 39.22 41.0 39.0 41.0 36.5 41.0 44-45 39.052 40.0 39.0 41.0 36.0 41.0 46-47 39.1275 40.5 39.0 41.0 36.5 41.0 48-49 39.377125 41.0 39.5 41.0 37.0 41.0 50-51 39.417625 41.0 40.0 41.0 37.0 41.0 52-53 39.19625 41.0 39.0 41.0 36.0 41.0 54-55 38.913875000000004 41.0 39.0 41.0 35.0 41.0 56-57 38.7315 41.0 38.5 41.0 35.0 41.0 58-59 38.559749999999994 40.0 38.0 41.0 35.0 41.0 60-61 38.44425 40.0 38.0 41.0 34.5 41.0 62-63 38.174875 40.0 37.0 41.0 34.0 41.0 64-65 37.836125 39.5 37.0 41.0 34.0 41.0 66-67 37.478875 39.0 36.0 41.0 34.0 41.0 68-69 37.055125000000004 39.0 35.5 40.5 33.5 41.0 70-71 36.597750000000005 37.5 35.0 40.0 33.0 41.0 72-73 36.075874999999996 37.0 35.0 39.0 32.5 41.0 74-75 35.559250000000006 36.5 35.0 39.0 32.0 40.5 76-77 34.547125 35.5 34.0 37.0 30.5 39.0 78-79 34.493375 35.0 34.0 37.0 31.0 39.0 80-81 34.231375 35.0 34.5 37.0 30.5 38.5 82-83 34.026625 35.0 34.0 36.0 31.0 37.0 84-85 33.7325 35.0 34.0 36.0 31.0 37.0 86-87 33.52275 35.0 34.0 36.0 30.0 36.5 88-89 33.161500000000004 35.0 34.0 35.0 30.0 36.0 90-91 32.95025 35.0 34.0 35.0 29.5 36.0 92-93 32.828875 35.0 34.0 35.0 29.5 36.0 94-95 32.692499999999995 35.0 34.0 35.0 29.5 35.5 96-97 32.204625 35.0 34.0 35.0 28.0 35.0 98-99 31.615125 35.0 32.5 35.0 26.0 35.0 100 31.23775 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 5.0 12 2.0 13 4.0 14 3.0 15 3.0 16 2.0 17 0.0 18 3.0 19 6.0 20 2.0 21 11.0 22 11.0 23 9.0 24 9.0 25 10.0 26 7.0 27 12.0 28 24.0 29 24.0 30 26.0 31 38.0 32 65.0 33 65.0 34 107.0 35 161.0 36 322.0 37 908.0 38 1748.0 39 412.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.83055775839281 13.71927042030135 18.265926513349193 41.184245307956644 2 19.075 23.075000000000003 38.2 19.650000000000002 3 21.6 27.375 28.4 22.625 4 24.675 32.15 20.65 22.525000000000002 5 24.462231115557778 35.867933966983486 21.98599299649825 17.68384192096048 6 18.7 38.2 23.974999999999998 19.125 7 15.725 16.35 44.625 23.3 8 18.3 23.225 29.725 28.749999999999996 9 19.3 21.95 31.974999999999998 26.775 10-11 22.8125 32.7125 22.8 21.675 12-13 20.65 25.924999999999997 30.15 23.275000000000002 14-15 19.6875 28.4375 29.037499999999998 22.8375 16-17 21.973486743371687 27.151075537768882 28.101550775387697 22.773886943471737 18-19 22.112499999999997 28.125 27.5625 22.2 20-21 21.375 28.487499999999997 27.537499999999998 22.6 22-23 22.0625 28.449999999999996 27.0875 22.400000000000002 24-25 21.45 28.9 27.725 21.925 26-27 21.3125 29.349999999999998 27.437499999999996 21.9 28-29 21.475 27.55 28.625 22.35 30-31 20.8625 28.849999999999998 28.487499999999997 21.8 32-33 21.4875 28.775000000000002 27.6125 22.125 34-35 21.8875 28.225 28.262500000000003 21.625 36-37 21.587500000000002 28.9125 27.3625 22.1375 38-39 22.075 28.262500000000003 27.450000000000003 22.2125 40-41 21.575 29.425 26.75 22.25 42-43 21.125 28.6125 28.462500000000002 21.8 44-45 21.2625 28.4375 27.8375 22.4625 46-47 21.175 28.275 28.262500000000003 22.287499999999998 48-49 21.5375 27.224999999999998 28.275 22.9625 50-51 21.837500000000002 28.262500000000003 27.237499999999997 22.662499999999998 52-53 21.3 29.099999999999998 27.250000000000004 22.35 54-55 21.435717858929465 29.027013506753374 27.126063031515756 22.411205602801402 56-57 22.2 28.799999999999997 27.250000000000004 21.75 58-59 21.7875 28.425 28.325 21.462500000000002 60-61 21.212500000000002 28.4125 28.1125 22.2625 62-63 21.337500000000002 28.3125 28.4 21.95 64-65 21.837500000000002 27.6125 28.287499999999998 22.2625 66-67 21.1875 27.950000000000003 27.925 22.9375 68-69 22.4875 26.924999999999997 28.212500000000002 22.375 70-71 21.512500000000003 28.199999999999996 28.425 21.8625 72-73 21.275 28.287499999999998 28.15 22.287499999999998 74-75 21.875 28.525 27.800000000000004 21.8 76-77 22.6125 27.6 28.5875 21.2 78-79 21.8875 28.15 27.1625 22.8 80-81 21.7375 28.425 28.012500000000003 21.825 82-83 21.85 27.737499999999997 27.975 22.4375 84-85 22.537499999999998 27.9125 27.85 21.7 86-87 21.637500000000003 28.0625 28.449999999999996 21.85 88-89 21.5 29.2 28.1625 21.1375 90-91 22.7625 28.4125 27.725 21.099999999999998 92-93 22.9625 28.575 27.55 20.9125 94-95 22.725 27.737499999999997 27.55 21.987499999999997 96-97 22.425 27.712500000000002 28.15 21.712500000000002 98-99 21.8 29.299999999999997 27.425 21.475 100 22.375 27.825 27.05 22.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.0 25 3.5 26 4.0 27 4.5 28 8.5 29 15.0 30 23.0 31 27.0 32 33.0 33 45.5 34 59.0 35 72.0 36 100.5 37 128.0 38 149.0 39 178.0 40 201.0 41 223.0 42 245.5 43 253.5 44 259.5 45 252.0 46 241.0 47 238.5 48 233.0 49 212.5 50 174.5 51 142.0 52 115.0 53 85.0 54 54.5 55 43.0 56 38.5 57 30.0 58 19.5 59 14.0 60 17.0 61 13.5 62 5.5 63 5.0 64 3.5 65 3.0 66 3.5 67 3.0 68 4.0 69 3.0 70 2.0 71 1.0 72 0.0 73 1.0 74 1.5 75 1.0 76 0.5 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.425 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.05 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.05 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020878 spots for SRR3207807.sra Written 2020878 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra Read 2020868 spots for SRR3207807.sra Written 2020868 spots for SRR3207807.sra SRR ids: ['SRR3207807.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a30xrfe8 SRR3207807.sra spots: 40417370 blocks: [[1, 2020868], [2020869, 4041736], [4041737, 6062604], [6062605, 8083472], [8083473, 10104340], [10104341, 12125208], [12125209, 14146076], [14146077, 16166944], [16166945, 18187812], [18187813, 20208680], [20208681, 22229548], [22229549, 24250416], [24250417, 26271284], [26271285, 28292152], [28292153, 30313020], [30313021, 32333888], [32333889, 34354756], [34354757, 36375624], [36375625, 38396492], [38396493, 40417370]] SRR3207807 file size 10507531 SRR3207807 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207807 SRR3207807_1.fastq Input file: SRR3207807_1.fastq trimmed: SRR3207807-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 00:43:21 2025 >> started Tue Feb 11 00:43:39 2025 >> done (18.734s) 40417370 reads processed; of these: 3876 ( 0.01%) short reads filtered out after trimming by size control 12113 ( 0.03%) empty reads filtered out after trimming by size control 40401381 (99.96%) reads available; of these: 7068074 (17.49%) trimmed reads available after processing 33333307 (82.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 637 0.00% 19 823 0.00% 20 1097 0.00% 21 1508 0.00% 22 2014 0.00% 23 3046 0.01% 24 3745 0.01% 25 4920 0.01% 26 5092 0.01% 27 5188 0.01% 28 4917 0.01% 29 5221 0.01% 30 5323 0.01% 31 5579 0.01% 32 5722 0.01% 33 5849 0.01% 34 6132 0.02% 35 6356 0.02% 36 6445 0.02% 37 6685 0.02% 38 6713 0.02% 39 6770 0.02% 40 6892 0.02% 41 7026 0.02% 42 7350 0.02% 43 7545 0.02% 44 7480 0.02% 45 7657 0.02% 46 8073 0.02% 47 7731 0.02% 48 8264 0.02% 49 8178 0.02% 50 8729 0.02% 51 9415 0.02% 52 9956 0.02% 53 10651 0.03% 54 10271 0.03% 55 10202 0.03% 56 10844 0.03% 57 11159 0.03% 58 11644 0.03% 59 12235 0.03% 60 12332 0.03% 61 12415 0.03% 62 13284 0.03% 63 13404 0.03% 64 13547 0.03% 65 14409 0.04% 66 14897 0.04% 67 15561 0.04% 68 16603 0.04% 69 16488 0.04% 70 17637 0.04% 71 18221 0.05% 72 19257 0.05% 73 19938 0.05% 74 20344 0.05% 75 21187 0.05% 76 15235 0.04% 77 17489 0.04% 78 20755 0.05% 79 22999 0.06% 80 24854 0.06% 81 26353 0.07% 82 29300 0.07% 83 34141 0.08% 84 36398 0.09% 85 41171 0.10% 86 48059 0.12% 87 61173 0.15% 88 85184 0.21% 89 179294 0.44% 90 611983 1.51% 91 255676 0.63% 92 1075578 2.66% 93 232718 0.58% 94 635587 1.57% 95 356398 0.88% 96 949287 2.35% 97 351683 0.87% 98 948852 2.35% 99 467299 1.16% 100 33333307 82.51% 40401381 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=52.11 fanout-score-rank=7 prefix-density=0.44 prefix-fanout=35.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=237.59 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=25.4 sequence=TTCTTCTTCTTT Started job on | Feb 11 00:43:55 Started mapping on | Feb 11 00:43:56 Finished on | Feb 11 00:44:37 Mapping speed, Million of reads per hour | 3547.44 Number of input reads | 40401381 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 38926528 Uniquely mapped reads % | 96.35% Average mapped length | 98.10 Number of splices: Total | 11354673 Number of splices: Annotated (sjdb) | 11144462 Number of splices: GT/AG | 11186374 Number of splices: GC/AG | 138834 Number of splices: AT/AC | 10921 Number of splices: Non-canonical | 18544 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.02% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 881381 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 413539 % of reads mapped to too many loci | 1.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.44% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 593472 593472 593472 N_multimapping 881381 881381 881381 N_noFeature 1687310 20149469 20199230 N_ambiguous 402078 67886 69555 UnstrandedReadsAssigned:36837140 PositiveStrandReadsAssigned:18709173 NegativeStrandReadsAssigned:18657743 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207807 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207807-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,401,381 reads, 37,952,039 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR3207807.ke.tsv 34699 SRR3207807.se.tsv 87100 total ==> SRR3207807.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1152 24.5069 Potri.005G024800.1.v4.1 1035 936 87 3.79449 Potri.004G059700.1.v4.1 961 862 26 1.23134 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 628.721 9.02482 Potri.016G087400.1.v4.1 270 171 1822 434.973 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 167.577 4.08667 Potri.012G127500.1.v4.1 977 878 2288 106.383 ==> SRR3207807.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4782 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 677 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 105 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 13 SRR3207807 completed mapping pipeline successfully