Starting /dee2/code/volunteer_pipeline.sh SRR3207808 current disk space = 3057159479296 free memory = 1578867060 SRR3207808 SRAfilesize abc91920a74f346886feb128fe4589f1 SRR3207808.sra SRR3207808.sra file validated SRR3207808 is single end SRR3207808 is conventional basespace SRR3207808 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207808_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.283 34.0 33.0 34.0 31.0 34.0 2 32.35825 34.0 34.0 34.0 31.0 34.0 3 33.1645 34.0 34.0 34.0 31.0 34.0 4 36.5765 37.0 37.0 37.0 35.0 37.0 5 36.53075 37.0 37.0 37.0 35.0 37.0 6 36.63875 37.0 37.0 37.0 35.0 37.0 7 36.57 37.0 37.0 37.0 35.0 37.0 8 36.615 37.0 37.0 37.0 35.0 37.0 9 38.50775 39.0 39.0 39.0 37.0 39.0 10-11 38.546125 39.0 39.0 39.0 38.0 39.0 12-13 38.506 39.0 39.0 39.0 37.0 39.0 14-15 40.166125 41.0 40.0 41.0 38.0 41.0 16-17 40.06175 41.0 40.0 41.0 38.0 41.0 18-19 40.068124999999995 41.0 40.0 41.0 38.0 41.0 20-21 40.053 41.0 40.0 41.0 38.0 41.0 22-23 40.077375 41.0 40.0 41.0 38.0 41.0 24-25 39.961875 41.0 40.0 41.0 38.0 41.0 26-27 39.837125 41.0 40.0 41.0 38.0 41.0 28-29 39.736875 41.0 40.0 41.0 38.0 41.0 30-31 39.6045 41.0 40.0 41.0 37.5 41.0 32-33 39.535 41.0 40.0 41.0 37.0 41.0 34-35 39.314750000000004 41.0 39.5 41.0 36.5 41.0 36-37 39.14225 40.0 39.0 41.0 36.0 41.0 38-39 39.260000000000005 41.0 39.0 41.0 36.5 41.0 40-41 39.22475 41.0 39.0 41.0 36.5 41.0 42-43 39.148875000000004 41.0 39.0 41.0 36.0 41.0 44-45 38.992875 40.0 39.0 41.0 35.0 41.0 46-47 39.008125 40.5 39.0 41.0 35.5 41.0 48-49 39.285875000000004 41.0 39.5 41.0 37.0 41.0 50-51 39.283375 41.0 40.0 41.0 36.5 41.0 52-53 39.095625 41.0 39.0 41.0 36.0 41.0 54-55 38.874625 41.0 39.0 41.0 35.0 41.0 56-57 38.63125 40.5 38.5 41.0 35.0 41.0 58-59 38.508875 40.0 38.0 41.0 35.0 41.0 60-61 38.339875 40.0 38.0 41.0 35.0 41.0 62-63 38.023624999999996 40.0 37.0 41.0 34.0 41.0 64-65 37.746375 39.5 36.5 41.0 34.0 41.0 66-67 37.397125 39.0 36.0 41.0 34.0 41.0 68-69 36.958625 38.5 35.5 40.5 33.5 41.0 70-71 36.47387500000001 37.5 35.0 39.5 33.0 41.0 72-73 36.03375 37.0 35.0 39.0 32.5 41.0 74-75 35.512125 36.5 35.0 39.0 32.0 40.5 76-77 34.4675 35.0 34.0 37.0 30.5 39.0 78-79 34.515874999999994 35.0 34.0 37.0 30.5 39.0 80-81 34.228125000000006 35.0 34.5 36.5 30.5 38.5 82-83 33.952625 35.0 34.0 36.0 30.5 37.0 84-85 33.670125 35.0 34.0 36.0 30.5 37.0 86-87 33.436499999999995 35.0 34.0 35.5 30.0 36.5 88-89 33.084500000000006 35.0 34.0 35.0 29.5 36.0 90-91 32.858625 35.0 34.0 35.0 29.0 36.0 92-93 32.701375 35.0 34.0 35.0 29.0 36.0 94-95 32.515874999999994 35.0 34.0 35.0 29.0 35.0 96-97 32.129 35.0 33.5 35.0 28.0 35.0 98-99 31.448124999999997 35.0 33.0 35.0 25.5 35.0 100 31.08725 35.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 2.0 11 5.0 12 1.0 13 4.0 14 4.0 15 3.0 16 7.0 17 3.0 18 7.0 19 4.0 20 1.0 21 7.0 22 6.0 23 8.0 24 12.0 25 8.0 26 6.0 27 22.0 28 16.0 29 20.0 30 32.0 31 41.0 32 51.0 33 73.0 34 108.0 35 165.0 36 331.0 37 938.0 38 1726.0 39 386.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.644158628081456 15.460878885316184 17.229367631296892 38.66559485530547 2 19.175 24.15 38.1 18.575 3 22.825 27.1 27.150000000000002 22.925 4 25.224999999999998 32.25 19.950000000000003 22.575 5 24.54954954954955 36.88688688688689 22.47247247247247 16.09109109109109 6 18.224999999999998 37.25 24.6 19.925 7 15.125 16.6 46.2 22.075 8 19.35 22.1 30.525000000000002 28.025 9 21.2 23.849999999999998 30.049999999999997 24.9 10-11 22.3 33.9125 22.4875 21.3 12-13 20.375 26.575 30.625000000000004 22.425 14-15 21.0375 27.987499999999997 29.299999999999997 21.675 16-17 21.93322495935976 27.560335125672125 28.635738401900714 21.8707015130674 18-19 21.6 27.725 28.675 22.0 20-21 21.4875 28.762500000000003 27.287499999999998 22.4625 22-23 22.287499999999998 28.925 26.6 22.1875 24-25 21.625 28.6375 28.3125 21.425 26-27 22.237499999999997 28.212500000000002 27.762500000000003 21.7875 28-29 21.575 28.6875 28.000000000000004 21.7375 30-31 20.974999999999998 28.6875 27.987499999999997 22.35 32-33 21.875 27.775 27.575 22.775000000000002 34-35 21.55 28.1875 28.287499999999998 21.975 36-37 21.7402175271909 28.253531691461433 27.51593949243655 22.490311288911112 38-39 21.677709713714215 29.091136392049005 27.065883235404424 22.165270658832352 40-41 21.7 29.312500000000004 27.175 21.8125 42-43 22.2 27.9375 28.7375 21.125 44-45 22.875 28.375 27.800000000000004 20.95 46-47 21.762500000000003 27.9125 28.9875 21.337500000000002 48-49 21.9375 27.8625 28.012500000000003 22.1875 50-51 22.037499999999998 29.512500000000003 27.175 21.275 52-53 22.1 28.462500000000002 27.450000000000003 21.987499999999997 54-55 22.005501375343837 27.906976744186046 27.26931732933233 22.818204551137786 56-57 21.9 28.0875 28.249999999999996 21.762500000000003 58-59 22.0 28.037499999999998 28.0625 21.9 60-61 22.2625 28.487499999999997 26.974999999999998 22.275 62-63 21.4 28.825 28.212500000000002 21.5625 64-65 21.4875 28.725 27.5875 22.2 66-67 21.775 26.937499999999996 28.65 22.6375 68-69 22.2125 27.750000000000004 28.5875 21.45 70-71 21.912499999999998 28.3625 27.287499999999998 22.4375 72-73 21.6875 28.287499999999998 28.1125 21.912499999999998 74-75 22.85 27.025 28.6625 21.462500000000002 76-77 22.14026753344168 28.403550443805475 27.61595199399925 21.840230028753595 78-79 21.712500000000002 28.025 28.475 21.7875 80-81 22.112499999999997 27.35 27.987499999999997 22.55 82-83 22.05 28.575 26.7625 22.6125 84-85 22.5625 27.500000000000004 27.6625 22.275 86-87 21.725 28.8375 28.1375 21.3 88-89 22.8125 28.3125 27.575 21.3 90-91 22.702837854731843 27.365920740092513 28.30353794224278 21.627703462932867 92-93 22.537499999999998 27.55 27.9125 22.0 94-95 22.925 27.325 27.325 22.425 96-97 22.2 27.762500000000003 28.425 21.6125 98-99 22.1875 28.5875 28.3625 20.8625 100 21.95 28.575 26.974999999999998 22.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.5 25 2.0 26 4.0 27 7.0 28 10.5 29 15.0 30 22.5 31 28.5 32 36.0 33 51.5 34 59.5 35 74.0 36 86.0 37 105.0 38 138.0 39 165.5 40 190.0 41 219.0 42 239.5 43 255.5 44 273.0 45 274.0 46 280.0 47 268.0 48 229.0 49 191.5 50 173.0 51 133.5 52 100.5 53 89.5 54 63.0 55 52.0 56 40.5 57 25.5 58 16.0 59 12.5 60 13.0 61 8.5 62 5.5 63 5.0 64 5.5 65 4.0 66 3.0 67 4.0 68 3.0 69 1.5 70 0.5 71 1.0 72 2.0 73 2.0 74 1.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.7 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0375 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.0125 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.025 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227628 spots for SRR3207808.sra Written 2227628 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra Read 2227616 spots for SRR3207808.sra Written 2227616 spots for SRR3207808.sra SRR ids: ['SRR3207808.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bmohm9cq SRR3207808.sra spots: 44552332 blocks: [[1, 2227616], [2227617, 4455232], [4455233, 6682848], [6682849, 8910464], [8910465, 11138080], [11138081, 13365696], [13365697, 15593312], [15593313, 17820928], [17820929, 20048544], [20048545, 22276160], [22276161, 24503776], [24503777, 26731392], [26731393, 28959008], [28959009, 31186624], [31186625, 33414240], [33414241, 35641856], [35641857, 37869472], [37869473, 40097088], [40097089, 42324704], [42324705, 44552332]] SRR3207808 file size 11583618 SRR3207808 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207808 SRR3207808_1.fastq Input file: SRR3207808_1.fastq trimmed: SRR3207808-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 01:14:36 2025 >> started Tue Feb 11 01:14:57 2025 >> done (21.140s) 44552332 reads processed; of these: 5865 ( 0.01%) short reads filtered out after trimming by size control 20386 ( 0.05%) empty reads filtered out after trimming by size control 44526081 (99.94%) reads available; of these: 8006316 (17.98%) trimmed reads available after processing 36519765 (82.02%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 945 0.00% 19 1232 0.00% 20 1435 0.00% 21 1902 0.00% 22 2561 0.01% 23 3846 0.01% 24 4755 0.01% 25 6184 0.01% 26 6159 0.01% 27 6120 0.01% 28 6009 0.01% 29 6264 0.01% 30 6687 0.02% 31 6561 0.01% 32 7054 0.02% 33 6989 0.02% 34 7299 0.02% 35 7530 0.02% 36 8067 0.02% 37 7995 0.02% 38 8208 0.02% 39 8246 0.02% 40 8502 0.02% 41 8584 0.02% 42 8771 0.02% 43 9163 0.02% 44 9055 0.02% 45 9266 0.02% 46 9687 0.02% 47 9360 0.02% 48 9822 0.02% 49 9943 0.02% 50 10520 0.02% 51 11249 0.03% 52 11827 0.03% 53 12363 0.03% 54 12141 0.03% 55 12422 0.03% 56 13094 0.03% 57 13300 0.03% 58 14155 0.03% 59 14037 0.03% 60 14522 0.03% 61 14672 0.03% 62 15303 0.03% 63 15437 0.03% 64 15602 0.04% 65 17258 0.04% 66 17467 0.04% 67 18250 0.04% 68 19250 0.04% 69 19409 0.04% 70 20420 0.05% 71 21164 0.05% 72 22168 0.05% 73 23293 0.05% 74 23580 0.05% 75 24553 0.06% 76 17831 0.04% 77 20206 0.05% 78 24034 0.05% 79 26367 0.06% 80 28343 0.06% 81 30591 0.07% 82 34001 0.08% 83 39227 0.09% 84 42035 0.09% 85 48038 0.11% 86 56020 0.13% 87 70330 0.16% 88 99506 0.22% 89 206959 0.46% 90 705808 1.59% 91 300999 0.68% 92 1267487 2.85% 93 262633 0.59% 94 723905 1.63% 95 377133 0.85% 96 986450 2.22% 97 395898 0.89% 98 1070973 2.41% 99 529885 1.19% 100 36519765 82.02% 44526081 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=26.13 fanout-score-rank=6 prefix-density=0.18 prefix-fanout=22.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=12 fanout-score=165.23 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=22.7 sequence=AAGAAGAAGAAA Started job on | Feb 11 01:15:12 Started mapping on | Feb 11 01:15:13 Finished on | Feb 11 01:15:56 Mapping speed, Million of reads per hour | 3727.76 Number of input reads | 44526081 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 42613277 Uniquely mapped reads % | 95.70% Average mapped length | 98.07 Number of splices: Total | 12151973 Number of splices: Annotated (sjdb) | 11930555 Number of splices: GT/AG | 11972167 Number of splices: GC/AG | 147535 Number of splices: AT/AC | 11485 Number of splices: Non-canonical | 20786 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1002614 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 695540 % of reads mapped to too many loci | 1.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 910190 910190 910190 N_multimapping 1002614 1002614 1002614 N_noFeature 1792400 22033320 22067511 N_ambiguous 453786 73963 75569 UnstrandedReadsAssigned:40367091 PositiveStrandReadsAssigned:20505994 NegativeStrandReadsAssigned:20470197 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207808 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207808-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,526,081 reads, 41,844,148 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR3207808.ke.tsv 34699 SRR3207808.se.tsv 87100 total ==> SRR3207808.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1106 20.6547 Potri.005G024800.1.v4.1 1035 936 104 3.98195 Potri.004G059700.1.v4.1 961 862 34 1.41355 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 666.925 8.40398 Potri.016G087400.1.v4.1 270 171 2235 468.403 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 202 4.32448 Potri.012G127500.1.v4.1 977 878 2923 119.309 ==> SRR3207808.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5992 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 815 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 104 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 17 SRR3207808 completed mapping pipeline successfully