Starting /dee2/code/volunteer_pipeline.sh SRR3207809 current disk space = 3057380503552 free memory = 1130006048 SRR3207809 SRAfilesize 6179e04a5f7cbec3e01708685f7c80af SRR3207809.sra SRR3207809.sra file validated SRR3207809 is single end SRR3207809 is conventional basespace SRR3207809 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207809_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6215 34.0 33.0 34.0 31.0 34.0 2 33.07775 34.0 34.0 34.0 31.0 34.0 3 33.3635 34.0 34.0 34.0 31.0 34.0 4 36.65875 37.0 37.0 37.0 35.0 37.0 5 36.62725 37.0 37.0 37.0 35.0 37.0 6 36.67825 37.0 37.0 37.0 35.0 37.0 7 36.6295 37.0 37.0 37.0 35.0 37.0 8 36.616 37.0 37.0 37.0 35.0 37.0 9 38.3715 39.0 39.0 39.0 37.0 39.0 10-11 38.56275 39.0 39.0 39.0 37.5 39.0 12-13 38.533125 39.0 39.0 39.0 37.0 39.0 14-15 40.179249999999996 41.0 40.0 41.0 38.0 41.0 16-17 40.07725 41.0 40.0 41.0 38.0 41.0 18-19 39.992625000000004 41.0 40.0 41.0 38.0 41.0 20-21 40.075874999999996 41.0 40.0 41.0 38.0 41.0 22-23 39.982875 41.0 40.0 41.0 38.0 41.0 24-25 39.9585 41.0 40.0 41.0 38.0 41.0 26-27 39.856875 41.0 40.0 41.0 38.0 41.0 28-29 39.77075 41.0 40.0 41.0 38.0 41.0 30-31 39.650499999999994 41.0 40.0 41.0 37.5 41.0 32-33 39.533125 41.0 40.0 41.0 37.0 41.0 34-35 39.301625 40.5 39.5 41.0 36.5 41.0 36-37 39.168875 40.0 39.0 41.0 36.5 41.0 38-39 39.302625000000006 41.0 39.0 41.0 37.0 41.0 40-41 39.218875 41.0 39.0 41.0 36.5 41.0 42-43 39.236625000000004 41.0 39.0 41.0 36.5 41.0 44-45 39.025125 40.0 39.0 41.0 36.0 41.0 46-47 39.137874999999994 40.5 39.0 41.0 36.0 41.0 48-49 39.376000000000005 41.0 39.0 41.0 37.0 41.0 50-51 39.361125 41.0 39.5 41.0 37.0 41.0 52-53 39.156625000000005 41.0 39.0 41.0 35.5 41.0 54-55 38.886250000000004 41.0 39.0 41.0 35.0 41.0 56-57 38.699625 40.5 38.5 41.0 35.0 41.0 58-59 38.561875 40.0 38.0 41.0 35.0 41.0 60-61 38.3785 40.0 37.5 41.0 35.0 41.0 62-63 38.12425 40.0 37.0 41.0 34.5 41.0 64-65 37.81 39.0 36.5 41.0 34.0 41.0 66-67 37.457875 39.0 36.0 41.0 34.0 41.0 68-69 36.882000000000005 38.5 35.5 40.5 33.0 41.0 70-71 36.36475 37.0 35.0 39.5 32.0 41.0 72-73 35.97525 37.0 35.0 39.0 32.0 41.0 74-75 35.497125 36.0 35.0 39.0 32.0 40.5 76-77 34.438625 35.0 34.0 37.0 30.5 39.0 78-79 34.401875000000004 35.0 34.0 37.0 30.5 39.0 80-81 34.17875 35.0 34.0 36.5 31.0 38.0 82-83 33.931 35.0 34.0 36.0 31.0 37.0 84-85 33.71425 35.0 34.0 36.0 31.0 37.0 86-87 33.426249999999996 35.0 34.0 35.5 30.0 36.0 88-89 33.05275 35.0 34.0 35.0 29.0 36.0 90-91 32.847875 35.0 34.0 35.0 29.0 36.0 92-93 32.768 35.0 34.0 35.0 29.5 36.0 94-95 32.458875 35.0 34.0 35.0 29.0 35.0 96-97 32.1245 35.0 33.5 35.0 27.5 35.0 98-99 31.543374999999997 35.0 32.5 35.0 26.0 35.0 100 31.172 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 0.0 11 2.0 12 3.0 13 2.0 14 1.0 15 1.0 16 7.0 17 1.0 18 5.0 19 4.0 20 8.0 21 5.0 22 7.0 23 12.0 24 8.0 25 12.0 26 19.0 27 13.0 28 19.0 29 18.0 30 23.0 31 30.0 32 60.0 33 83.0 34 95.0 35 164.0 36 347.0 37 969.0 38 1712.0 39 367.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.265984654731454 15.421994884910486 18.081841432225062 40.23017902813299 2 18.825 23.674999999999997 37.75 19.75 3 21.85 27.05 27.05 24.05 4 24.95 33.975 20.349999999999998 20.724999999999998 5 24.33108277069267 36.284071017754435 22.355588897224308 17.029257314328582 6 18.2 37.625 23.599999999999998 20.575 7 15.85 18.975 44.574999999999996 20.599999999999998 8 18.425 22.95 29.325000000000003 29.299999999999997 9 19.375 22.875 32.2 25.55 10-11 22.75 34.300000000000004 22.2625 20.6875 12-13 20.5 27.35 29.075 23.075000000000003 14-15 21.0125 28.537499999999998 28.537499999999998 21.912499999999998 16-17 22.715339417427177 27.765970746343292 27.00337542192774 22.515314414301788 18-19 21.425 28.075 27.474999999999998 23.025000000000002 20-21 21.0125 28.599999999999998 28.4375 21.95 22-23 22.0875 28.749999999999996 28.037499999999998 21.125 24-25 21.0375 29.349999999999998 27.325 22.287499999999998 26-27 21.1125 29.225 27.700000000000003 21.9625 28-29 21.0125 29.7 27.1125 22.175 30-31 21.087500000000002 29.049999999999997 27.4125 22.45 32-33 21.987499999999997 29.0875 27.425 21.5 34-35 21.025 28.1 27.962500000000002 22.912499999999998 36-37 21.3 29.15 27.5625 21.987499999999997 38-39 22.35 28.6375 27.5125 21.5 40-41 21.0 28.9875 27.825 22.1875 42-43 20.9375 29.125 28.1875 21.75 44-45 21.5375 28.125 27.6875 22.650000000000002 46-47 22.225 29.4875 27.075 21.212500000000002 48-49 22.287499999999998 28.299999999999997 28.050000000000004 21.3625 50-51 21.85 28.275 28.199999999999996 21.675 52-53 22.2125 28.3875 27.6375 21.762500000000003 54-55 21.440180022502815 28.778597324665583 27.97849731216402 21.802725340667585 56-57 22.15 28.812500000000004 27.625 21.4125 58-59 21.462500000000002 28.1375 28.375 22.025 60-61 20.9125 28.050000000000004 28.425 22.6125 62-63 21.512500000000003 27.9375 27.9125 22.6375 64-65 21.099999999999998 27.825 28.1 22.975 66-67 21.925 29.25 27.4125 21.4125 68-69 22.2625 28.8875 27.487499999999997 21.3625 70-71 21.6 29.5375 27.3875 21.475 72-73 21.775 27.650000000000002 28.6375 21.9375 74-75 22.112499999999997 28.000000000000004 27.962500000000002 21.925 76-77 23.0875 28.000000000000004 27.425 21.4875 78-79 22.037499999999998 27.962500000000002 27.55 22.45 80-81 21.25 28.262500000000003 27.537499999999998 22.95 82-83 21.6625 28.000000000000004 28.199999999999996 22.1375 84-85 21.837500000000002 28.4125 27.700000000000003 22.05 86-87 21.775 28.775000000000002 27.9125 21.5375 88-89 21.75 28.037499999999998 28.3625 21.85 90-91 22.125 28.7375 27.05 22.0875 92-93 21.3125 29.299999999999997 27.200000000000003 22.1875 94-95 22.8375 28.849999999999998 27.462500000000002 20.849999999999998 96-97 21.7375 28.1375 27.975 22.15 98-99 21.85 28.349999999999998 27.875 21.925 100 22.3 29.049999999999997 27.975 20.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 2.0 24 5.0 25 4.5 26 4.5 27 6.0 28 8.5 29 12.5 30 20.0 31 28.0 32 40.5 33 51.0 34 62.5 35 82.0 36 100.0 37 117.5 38 144.0 39 167.0 40 190.5 41 226.5 42 249.0 43 272.5 44 282.0 45 272.5 46 258.0 47 231.5 48 221.0 49 191.0 50 150.5 51 128.0 52 102.0 53 93.0 54 77.0 55 46.5 56 34.0 57 27.5 58 15.5 59 12.5 60 14.0 61 10.0 62 4.5 63 3.5 64 6.0 65 7.5 66 5.5 67 2.0 68 1.5 69 1.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.037500000000000006 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.5875 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.85 0.0 0.0 0.0 0.0 88 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816519 spots for SRR3207809.sra Written 816519 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra Read 816503 spots for SRR3207809.sra Written 816503 spots for SRR3207809.sra SRR ids: ['SRR3207809.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s9ngn15v SRR3207809.sra spots: 16330076 blocks: [[1, 816503], [816504, 1633006], [1633007, 2449509], [2449510, 3266012], [3266013, 4082515], [4082516, 4899018], [4899019, 5715521], [5715522, 6532024], [6532025, 7348527], [7348528, 8165030], [8165031, 8981533], [8981534, 9798036], [9798037, 10614539], [10614540, 11431042], [11431043, 12247545], [12247546, 13064048], [13064049, 13880551], [13880552, 14697054], [14697055, 15513557], [15513558, 16330076]] SRR3207809 file size 4238925 SRR3207809 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207809 SRR3207809_1.fastq Input file: SRR3207809_1.fastq trimmed: SRR3207809-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 00:22:08 2025 >> started Tue Feb 11 00:22:19 2025 >> done (10.832s) 16330076 reads processed; of these: 1499 ( 0.01%) short reads filtered out after trimming by size control 6121 ( 0.04%) empty reads filtered out after trimming by size control 16322456 (99.95%) reads available; of these: 2929715 (17.95%) trimmed reads available after processing 13392741 (82.05%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 276 0.00% 19 378 0.00% 20 1101 0.01% 21 597 0.00% 22 845 0.01% 23 1320 0.01% 24 1644 0.01% 25 2108 0.01% 26 2179 0.01% 27 2177 0.01% 28 2221 0.01% 29 2294 0.01% 30 2439 0.01% 31 2362 0.01% 32 2420 0.01% 33 2476 0.02% 34 2534 0.02% 35 2760 0.02% 36 2949 0.02% 37 2847 0.02% 38 2921 0.02% 39 3037 0.02% 40 3051 0.02% 41 3140 0.02% 42 3313 0.02% 43 3380 0.02% 44 3360 0.02% 45 3427 0.02% 46 3575 0.02% 47 3310 0.02% 48 3894 0.02% 49 3801 0.02% 50 3790 0.02% 51 4343 0.03% 52 4530 0.03% 53 4799 0.03% 54 4599 0.03% 55 4785 0.03% 56 4854 0.03% 57 4902 0.03% 58 5303 0.03% 59 5674 0.03% 60 5729 0.04% 61 6118 0.04% 62 6414 0.04% 63 6069 0.04% 64 6148 0.04% 65 7165 0.04% 66 7627 0.05% 67 7633 0.05% 68 7634 0.05% 69 7326 0.04% 70 7938 0.05% 71 8240 0.05% 72 8333 0.05% 73 8933 0.05% 74 9104 0.06% 75 9462 0.06% 76 6837 0.04% 77 7705 0.05% 78 9112 0.06% 79 9959 0.06% 80 11043 0.07% 81 11712 0.07% 82 13160 0.08% 83 15026 0.09% 84 16034 0.10% 85 18235 0.11% 86 21512 0.13% 87 27083 0.17% 88 37687 0.23% 89 78983 0.48% 90 262204 1.61% 91 110390 0.68% 92 423372 2.59% 93 100654 0.62% 94 269635 1.65% 95 138705 0.85% 96 350055 2.14% 97 152177 0.93% 98 395553 2.42% 99 197294 1.21% 100 13392741 82.05% 16322456 reads passed initial QC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=59.01 fanout-score-rank=4 prefix-density=1.28 prefix-fanout=40.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=2 fanout-score=173.65 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=22.7 sequence=AAGAAGAAGAAA Started job on | Feb 11 00:22:37 Started mapping on | Feb 11 00:22:37 Finished on | Feb 11 00:22:55 Mapping speed, Million of reads per hour | 3264.49 Number of input reads | 16322456 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 15668363 Uniquely mapped reads % | 95.99% Average mapped length | 97.85 Number of splices: Total | 4273947 Number of splices: Annotated (sjdb) | 4197065 Number of splices: GT/AG | 4209716 Number of splices: GC/AG | 52145 Number of splices: AT/AC | 3924 Number of splices: Non-canonical | 8162 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380612 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 199673 % of reads mapped to too many loci | 1.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.44% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 273481 273481 273481 N_multimapping 380612 380612 380612 N_noFeature 614901 8059276 8106077 N_ambiguous 169584 25592 26351 UnstrandedReadsAssigned:14883878 PositiveStrandReadsAssigned:7583495 NegativeStrandReadsAssigned:7535935 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207809 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207809-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,322,456 reads, 15,376,228 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR3207809.ke.tsv 34699 SRR3207809.se.tsv 87100 total ==> SRR3207809.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 347 16.092 Potri.005G024800.1.v4.1 1035 936 47 4.46866 Potri.004G059700.1.v4.1 961 862 17 1.75508 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 260.086 8.13844 Potri.016G087400.1.v4.1 270 171 940 489.2 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 51 2.71125 Potri.012G127500.1.v4.1 977 878 2059 208.697 ==> SRR3207809.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1580 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 323 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 31 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR3207809 completed mapping pipeline successfully