Starting /dee2/code/volunteer_pipeline.sh SRR3207810 current disk space = 3057430745088 free memory = 1504009164 SRR3207810 SRAfilesize 7cfc2b7f464911f9ac4ce557a55370fa SRR3207810.sra SRR3207810.sra file validated SRR3207810 is single end SRR3207810 is conventional basespace SRR3207810 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207810_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5645 34.0 33.0 34.0 31.0 34.0 2 33.0465 34.0 34.0 34.0 31.0 34.0 3 33.3735 34.0 34.0 34.0 31.0 34.0 4 36.6845 37.0 37.0 37.0 35.0 37.0 5 36.58875 37.0 37.0 37.0 35.0 37.0 6 36.6255 37.0 37.0 37.0 35.0 37.0 7 36.6045 37.0 37.0 37.0 35.0 37.0 8 36.632 37.0 37.0 37.0 35.0 37.0 9 38.373 39.0 39.0 39.0 37.0 39.0 10-11 38.547375 39.0 39.0 39.0 38.0 39.0 12-13 38.544250000000005 39.0 39.0 39.0 37.0 39.0 14-15 40.207125 41.0 40.0 41.0 38.0 41.0 16-17 40.074875 41.0 40.0 41.0 38.0 41.0 18-19 40.075874999999996 41.0 40.0 41.0 38.0 41.0 20-21 40.0445 41.0 40.0 41.0 38.0 41.0 22-23 39.984 41.0 40.0 41.0 38.0 41.0 24-25 39.9535 41.0 40.0 41.0 38.0 41.0 26-27 39.83325 41.0 40.0 41.0 38.0 41.0 28-29 39.737125 41.0 40.0 41.0 38.0 41.0 30-31 39.60075 41.0 40.0 41.0 37.5 41.0 32-33 39.497 41.0 39.5 41.0 37.0 41.0 34-35 39.282250000000005 40.5 39.5 41.0 36.5 41.0 36-37 39.180625 40.0 39.0 41.0 37.0 41.0 38-39 39.258125 41.0 39.0 41.0 37.0 41.0 40-41 39.170500000000004 40.5 39.0 41.0 36.5 41.0 42-43 39.173249999999996 41.0 39.0 41.0 36.0 41.0 44-45 38.927 40.0 39.0 41.0 35.5 41.0 46-47 38.979625 40.5 38.5 41.0 35.5 41.0 48-49 39.225875 41.0 39.0 41.0 36.5 41.0 50-51 39.277375000000006 41.0 39.5 41.0 36.5 41.0 52-53 39.057125 41.0 39.0 41.0 35.5 41.0 54-55 38.85625 41.0 39.0 41.0 35.0 41.0 56-57 38.610749999999996 40.5 38.5 41.0 34.5 41.0 58-59 38.49825 40.0 38.0 41.0 35.0 41.0 60-61 38.414625 40.0 38.0 41.0 34.5 41.0 62-63 38.094 40.0 37.0 41.0 34.0 41.0 64-65 37.794375 39.5 36.5 41.0 34.0 41.0 66-67 37.4915 39.0 36.0 41.0 34.0 41.0 68-69 36.996 38.5 35.5 40.5 33.0 41.0 70-71 36.53725 37.5 35.0 39.5 33.0 41.0 72-73 36.1195 37.0 35.0 39.0 32.0 41.0 74-75 35.617374999999996 36.5 35.0 39.0 32.0 40.5 76-77 34.595875 35.5 34.0 37.0 30.5 39.0 78-79 34.539625 35.0 34.0 37.0 30.5 39.0 80-81 34.311625 35.0 34.0 37.0 31.0 38.5 82-83 33.97325 35.0 34.0 36.0 31.0 37.0 84-85 33.76575 35.0 34.0 36.0 31.0 37.0 86-87 33.543125 35.0 34.0 35.5 30.5 36.5 88-89 33.143 35.0 34.0 35.0 30.0 36.0 90-91 32.915 35.0 34.0 35.0 29.5 36.0 92-93 32.854875 35.0 34.0 35.0 29.5 36.0 94-95 32.595124999999996 35.0 34.0 35.0 29.0 35.0 96-97 32.20375 35.0 33.5 35.0 28.0 35.0 98-99 31.590125 35.0 32.5 35.0 26.0 35.0 100 31.308 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 0.0 10 5.0 11 3.0 12 2.0 13 3.0 14 1.0 15 3.0 16 3.0 17 1.0 18 5.0 19 8.0 20 7.0 21 4.0 22 9.0 23 6.0 24 3.0 25 5.0 26 6.0 27 10.0 28 22.0 29 25.0 30 40.0 31 36.0 32 56.0 33 70.0 34 106.0 35 173.0 36 336.0 37 949.0 38 1682.0 39 418.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.356557377049178 13.370901639344263 18.31454918032787 40.95799180327869 2 18.85 23.1 37.5 20.549999999999997 3 24.15 25.974999999999998 26.35 23.525 4 24.425 34.175 18.9 22.5 5 24.6996996996997 34.709709709709706 22.17217217217217 18.41841841841842 6 18.05 38.550000000000004 23.0 20.4 7 16.8 17.675 44.25 21.275 8 17.974999999999998 22.625 31.0 28.4 9 20.75 22.625 31.2 25.424999999999997 10-11 22.3125 33.15 22.5 22.037499999999998 12-13 21.075 25.9875 30.2375 22.7 14-15 21.3 27.700000000000003 28.7375 22.2625 16-17 21.355338834708675 27.619404851212803 27.7569392348087 23.268317079269817 18-19 21.975 28.4375 27.6125 21.975 20-21 22.075 28.0625 27.750000000000004 22.112499999999997 22-23 21.8 28.4375 27.237499999999997 22.525000000000002 24-25 20.95 28.9375 27.800000000000004 22.3125 26-27 21.337500000000002 28.962500000000002 28.000000000000004 21.7 28-29 22.5125 28.212500000000002 27.5125 21.762500000000003 30-31 21.712500000000002 28.275 27.675 22.3375 32-33 21.875 28.975 27.237499999999997 21.912499999999998 34-35 20.4125 28.8375 28.212500000000002 22.537499999999998 36-37 21.06776694173543 27.831957989497376 28.119529882470616 22.980745186296573 38-39 22.493123280820203 27.994498624656167 27.544386096524132 21.9679919979995 40-41 21.462500000000002 28.325 28.0625 22.15 42-43 21.712500000000002 27.437499999999996 28.0875 22.7625 44-45 22.412499999999998 27.5625 27.525 22.5 46-47 21.587500000000002 27.9375 28.15 22.325 48-49 21.224999999999998 26.974999999999998 29.6875 22.112499999999997 50-51 22.8125 27.8125 27.6 21.775 52-53 22.275 28.775000000000002 28.237499999999997 20.7125 54-55 23.068267066766694 28.094523630907727 27.231807951987996 21.605401350337583 56-57 22.412499999999998 28.262500000000003 27.4125 21.912499999999998 58-59 22.5 28.6375 27.35 21.512500000000003 60-61 21.6875 27.537499999999998 29.2375 21.5375 62-63 21.7875 27.650000000000002 27.8625 22.7 64-65 22.25 27.2625 28.6625 21.825 66-67 21.7375 28.3875 27.8125 22.0625 68-69 22.3 28.1 26.825 22.775000000000002 70-71 21.8625 28.0875 29.062500000000004 20.9875 72-73 22.0625 27.9125 28.487499999999997 21.5375 74-75 22.162499999999998 28.5875 27.6375 21.6125 76-77 21.9679919979995 28.219554888722183 27.694423605901473 22.118029507376843 78-79 21.4375 28.449999999999996 27.8875 22.225 80-81 22.1875 28.0625 27.6625 22.0875 82-83 22.3625 28.050000000000004 27.537499999999998 22.05 84-85 22.3375 27.5625 27.287499999999998 22.8125 86-87 21.025 28.249999999999996 28.6125 22.112499999999997 88-89 22.8 28.299999999999997 27.762500000000003 21.1375 90-91 21.75543885971493 28.432108027006752 28.444611152788195 21.36784196049012 92-93 22.400000000000002 28.6375 27.6 21.3625 94-95 22.05 28.725 27.875 21.349999999999998 96-97 22.475 29.049999999999997 27.250000000000004 21.224999999999998 98-99 22.4625 27.437499999999996 28.075 22.025 100 21.05 28.799999999999997 28.249999999999996 21.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 1.5 24 1.0 25 2.0 26 3.0 27 6.0 28 11.5 29 13.0 30 17.0 31 22.0 32 23.5 33 36.5 34 48.5 35 69.0 36 103.5 37 119.0 38 129.0 39 155.5 40 200.5 41 225.5 42 235.0 43 277.0 44 290.5 45 275.5 46 284.0 47 267.5 48 216.0 49 184.5 50 157.5 51 136.0 52 124.0 53 96.0 54 66.5 55 44.0 56 33.0 57 25.5 58 21.0 59 17.5 60 12.5 61 7.5 62 5.5 63 6.0 64 6.0 65 3.5 66 0.5 67 1.0 68 1.5 69 1.5 70 1.5 71 1.0 72 2.0 73 2.0 74 1.5 75 1.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.025 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.025 38-39 0.025 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.025 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908979 spots for SRR3207810.sra Written 908979 spots for SRR3207810.sra Read 908996 spots for SRR3207810.sra Written 908996 spots for SRR3207810.sra SRR ids: ['SRR3207810.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__lpqips4 SRR3207810.sra spots: 18179597 blocks: [[1, 908979], [908980, 1817958], [1817959, 2726937], [2726938, 3635916], [3635917, 4544895], [4544896, 5453874], [5453875, 6362853], [6362854, 7271832], [7271833, 8180811], [8180812, 9089790], [9089791, 9998769], [9998770, 10907748], [10907749, 11816727], [11816728, 12725706], [12725707, 13634685], [13634686, 14543664], [14543665, 15452643], [15452644, 16361622], [16361623, 17270601], [17270602, 18179597]] SRR3207810 file size 4720310 SRR3207810 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207810 SRR3207810_1.fastq Input file: SRR3207810_1.fastq trimmed: SRR3207810-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 00:46:48 2025 >> started Tue Feb 11 00:46:57 2025 >> done (9.922s) 18179597 reads processed; of these: 2013 ( 0.01%) short reads filtered out after trimming by size control 5145 ( 0.03%) empty reads filtered out after trimming by size control 18172439 (99.96%) reads available; of these: 3389811 (18.65%) trimmed reads available after processing 14782628 (81.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 297 0.00% 19 403 0.00% 20 508 0.00% 21 663 0.00% 22 866 0.00% 23 1365 0.01% 24 1736 0.01% 25 2230 0.01% 26 2422 0.01% 27 2298 0.01% 28 2262 0.01% 29 2455 0.01% 30 2552 0.01% 31 2551 0.01% 32 2636 0.01% 33 2733 0.02% 34 2782 0.02% 35 2971 0.02% 36 3016 0.02% 37 2982 0.02% 38 3276 0.02% 39 3161 0.02% 40 3133 0.02% 41 3317 0.02% 42 3582 0.02% 43 3666 0.02% 44 3777 0.02% 45 3550 0.02% 46 3804 0.02% 47 3748 0.02% 48 3930 0.02% 49 3999 0.02% 50 4139 0.02% 51 4458 0.02% 52 4679 0.03% 53 5039 0.03% 54 5003 0.03% 55 4924 0.03% 56 5322 0.03% 57 5279 0.03% 58 5690 0.03% 59 5780 0.03% 60 5789 0.03% 61 6076 0.03% 62 6307 0.03% 63 6480 0.04% 64 6349 0.03% 65 6881 0.04% 66 7280 0.04% 67 7542 0.04% 68 7983 0.04% 69 7912 0.04% 70 8441 0.05% 71 8733 0.05% 72 9125 0.05% 73 9723 0.05% 74 10127 0.06% 75 9948 0.05% 76 7466 0.04% 77 8446 0.05% 78 10036 0.06% 79 10984 0.06% 80 12194 0.07% 81 12723 0.07% 82 14259 0.08% 83 16433 0.09% 84 17507 0.10% 85 20370 0.11% 86 23713 0.13% 87 29559 0.16% 88 42100 0.23% 89 88487 0.49% 90 296457 1.63% 91 123004 0.68% 92 490213 2.70% 93 113047 0.62% 94 307610 1.69% 95 177625 0.98% 96 474647 2.61% 97 168366 0.93% 98 447024 2.46% 99 219861 1.21% 100 14782628 81.35% 18172439 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=62.34 fanout-score-rank=7 prefix-density=0.65 prefix-fanout=40.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=10 fanout-score=154.08 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=21.9 sequence=AAGAAGAAGAAA Started job on | Feb 11 00:47:12 Started mapping on | Feb 11 00:47:13 Finished on | Feb 11 00:47:37 Mapping speed, Million of reads per hour | 2725.87 Number of input reads | 18172439 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 17526242 Uniquely mapped reads % | 96.44% Average mapped length | 97.96 Number of splices: Total | 5095211 Number of splices: Annotated (sjdb) | 5005123 Number of splices: GT/AG | 5020769 Number of splices: GC/AG | 61287 Number of splices: AT/AC | 4848 Number of splices: Non-canonical | 8307 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 401661 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 148873 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 244536 244536 244536 N_multimapping 401661 401661 401661 N_noFeature 701967 9044610 9067109 N_ambiguous 175409 29307 29843 UnstrandedReadsAssigned:16648866 PositiveStrandReadsAssigned:8452325 NegativeStrandReadsAssigned:8429290 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207810 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207810-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,172,439 reads, 17,116,047 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR3207810.ke.tsv 34699 SRR3207810.se.tsv 87100 total ==> SRR3207810.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 420 19.4547 Potri.005G024800.1.v4.1 1035 936 44 4.17856 Potri.004G059700.1.v4.1 961 862 6 0.61872 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 303.216 9.47705 Potri.016G087400.1.v4.1 270 171 861.612 447.885 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 61.5844 3.27013 Potri.012G127500.1.v4.1 977 878 1521 153.987 ==> SRR3207810.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2097 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 27 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207810 completed mapping pipeline successfully