Starting /dee2/code/volunteer_pipeline.sh SRR3207811 current disk space = 3057423056896 free memory = 1238181844 SRR3207811 SRAfilesize 7ceb0406d390bb624e41085bc4c09a51 SRR3207811.sra SRR3207811.sra file validated SRR3207811 is single end SRR3207811 is conventional basespace SRR3207811 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207811_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7685 34.0 33.0 34.0 31.0 34.0 2 33.1335 34.0 34.0 34.0 31.0 34.0 3 33.366 34.0 34.0 34.0 31.0 34.0 4 36.658 37.0 37.0 37.0 35.0 37.0 5 36.59225 37.0 37.0 37.0 35.0 37.0 6 36.638 37.0 37.0 37.0 35.0 37.0 7 36.58525 37.0 37.0 37.0 35.0 37.0 8 36.618 37.0 37.0 37.0 35.0 37.0 9 38.3935 39.0 39.0 39.0 37.0 39.0 10-11 38.558375 39.0 39.0 39.0 37.5 39.0 12-13 38.52 39.0 39.0 39.0 37.0 39.0 14-15 40.160250000000005 41.0 40.0 41.0 38.0 41.0 16-17 40.069625 41.0 40.0 41.0 38.0 41.0 18-19 40.075125 41.0 40.0 41.0 38.0 41.0 20-21 40.068875 41.0 40.0 41.0 38.0 41.0 22-23 40.02175 41.0 40.0 41.0 38.0 41.0 24-25 39.96725 41.0 40.0 41.0 38.0 41.0 26-27 39.869875 41.0 40.0 41.0 38.0 41.0 28-29 39.77525 41.0 40.0 41.0 38.0 41.0 30-31 39.648624999999996 41.0 40.0 41.0 37.5 41.0 32-33 39.53425 41.0 40.0 41.0 37.0 41.0 34-35 39.287000000000006 41.0 39.5 41.0 36.5 41.0 36-37 39.125125 40.0 39.0 41.0 36.0 41.0 38-39 39.212 41.0 39.0 41.0 36.5 41.0 40-41 39.188375 41.0 39.0 41.0 36.0 41.0 42-43 39.20075 41.0 39.0 41.0 36.0 41.0 44-45 39.04675 40.5 39.0 41.0 36.0 41.0 46-47 39.0865 40.5 39.0 41.0 36.0 41.0 48-49 39.289625 41.0 39.0 41.0 36.0 41.0 50-51 39.327124999999995 41.0 40.0 41.0 37.0 41.0 52-53 39.149249999999995 41.0 39.0 41.0 36.0 41.0 54-55 38.839 41.0 39.0 41.0 35.0 41.0 56-57 38.66175 40.5 38.5 41.0 35.0 41.0 58-59 38.571749999999994 40.0 38.0 41.0 35.0 41.0 60-61 38.43375 40.0 38.0 41.0 35.0 41.0 62-63 38.158874999999995 40.0 37.0 41.0 34.5 41.0 64-65 37.755875 39.5 36.5 41.0 34.0 41.0 66-67 37.3525 39.0 36.0 41.0 34.0 41.0 68-69 36.96325 38.5 35.5 40.5 33.5 41.0 70-71 36.5025 37.0 35.0 39.5 33.0 41.0 72-73 36.064875 37.0 35.0 39.0 32.0 41.0 74-75 35.535375 36.5 35.0 39.0 32.0 40.0 76-77 34.515249999999995 35.0 34.0 37.0 30.5 39.0 78-79 34.517875000000004 35.0 34.5 37.0 31.0 39.0 80-81 34.171625 35.0 34.5 36.5 30.5 38.5 82-83 33.964749999999995 35.0 34.0 36.0 31.0 37.0 84-85 33.738125 35.0 34.0 36.0 31.0 37.0 86-87 33.487125000000006 35.0 34.0 35.5 31.0 36.5 88-89 33.146 35.0 34.0 35.0 30.0 36.0 90-91 32.904624999999996 35.0 34.0 35.0 30.0 36.0 92-93 32.72275 35.0 34.0 35.0 29.0 36.0 94-95 32.5145 35.0 34.0 35.0 29.0 35.0 96-97 32.143375000000006 35.0 33.5 35.0 28.0 35.0 98-99 31.644 35.0 33.0 35.0 26.0 35.0 100 31.30275 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 1.0 10 4.0 11 3.0 12 3.0 13 5.0 14 3.0 15 0.0 16 5.0 17 4.0 18 4.0 19 8.0 20 3.0 21 8.0 22 6.0 23 9.0 24 6.0 25 5.0 26 9.0 27 16.0 28 26.0 29 23.0 30 30.0 31 31.0 32 59.0 33 68.0 34 84.0 35 170.0 36 298.0 37 979.0 38 1717.0 39 411.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.382165605095544 14.1656050955414 16.687898089171973 40.76433121019109 2 18.725 23.05 38.074999999999996 20.150000000000002 3 22.525000000000002 26.150000000000002 27.55 23.775 4 23.925 32.4 21.099999999999998 22.575 5 24.7935951963973 36.12709532149112 20.665499124343256 18.413810357768327 6 17.825 38.35 24.15 19.675 7 16.075 18.025 43.925 21.975 8 19.400000000000002 23.025000000000002 29.4 28.175 9 20.349999999999998 22.825 31.125000000000004 25.7 10-11 22.2625 33.0 22.912499999999998 21.825 12-13 19.7125 27.0625 30.2 23.025000000000002 14-15 20.724999999999998 27.8875 29.175 22.2125 16-17 21.41517689711214 28.26603325415677 27.61595199399925 22.702837854731843 18-19 21.349999999999998 28.3125 27.787499999999998 22.55 20-21 21.55 28.775000000000002 27.5625 22.112499999999997 22-23 21.0625 28.487499999999997 27.962500000000002 22.4875 24-25 21.5 28.287499999999998 27.437499999999996 22.775000000000002 26-27 20.849999999999998 28.962500000000002 27.787499999999998 22.400000000000002 28-29 21.175 28.6375 27.6 22.5875 30-31 22.162499999999998 28.275 27.075 22.4875 32-33 21.575 28.4 27.2625 22.7625 34-35 22.037499999999998 28.712500000000002 27.275 21.975 36-37 21.840230028753595 28.66608326040755 27.353419177397175 22.14026753344168 38-39 21.790223777972244 27.86598324790599 27.378422302787847 22.96537067133392 40-41 22.0875 28.449999999999996 26.8125 22.650000000000002 42-43 21.55 28.075 27.6375 22.7375 44-45 21.0125 29.175 27.5125 22.3 46-47 21.4375 28.262500000000003 28.487499999999997 21.8125 48-49 22.1 28.6125 27.800000000000004 21.4875 50-51 21.6875 27.975 27.800000000000004 22.537499999999998 52-53 22.225 28.775000000000002 27.275 21.725 54-55 21.840230028753595 28.2410301287661 27.65345668208526 22.26528316039505 56-57 21.212500000000002 27.5875 28.4375 22.7625 58-59 21.525 28.6375 26.950000000000003 22.8875 60-61 20.95 28.7 28.125 22.225 62-63 21.9625 28.65 27.787499999999998 21.6 64-65 21.8125 28.249999999999996 27.3 22.6375 66-67 22.5 27.800000000000004 28.287499999999998 21.4125 68-69 21.4875 28.375 27.712500000000002 22.425 70-71 21.475 28.537499999999998 27.700000000000003 22.287499999999998 72-73 22.175 27.462500000000002 28.025 22.3375 74-75 22.05 27.6 28.725 21.625 76-77 22.440305038129765 28.2410301287661 27.69096137017127 21.627703462932867 78-79 21.6625 28.487499999999997 27.750000000000004 22.1 80-81 22.85 28.000000000000004 28.225 20.925 82-83 21.637500000000003 28.325 28.525 21.512500000000003 84-85 21.775 27.725 28.3875 22.112499999999997 86-87 22.675 27.0625 28.287499999999998 21.975 88-89 22.125 28.4375 27.85 21.587500000000002 90-91 23.265408176022003 27.29091136392049 27.778472309038634 21.665208151018877 92-93 22.05 27.6625 27.762500000000003 22.525000000000002 94-95 22.05 27.737499999999997 28.237499999999997 21.975 96-97 21.725 28.050000000000004 28.237499999999997 21.987499999999997 98-99 21.837500000000002 28.325 28.0875 21.75 100 21.05 27.6 28.449999999999996 22.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.5 23 0.5 24 2.0 25 4.5 26 7.5 27 12.0 28 14.0 29 11.5 30 16.5 31 28.0 32 33.5 33 46.5 34 62.0 35 69.5 36 81.5 37 100.5 38 120.0 39 156.0 40 197.0 41 205.5 42 225.5 43 267.5 44 289.0 45 285.0 46 271.0 47 270.5 48 238.5 49 187.5 50 160.5 51 135.0 52 111.0 53 97.5 54 74.0 55 48.0 56 37.5 57 27.5 58 20.0 59 15.0 60 11.5 61 10.5 62 9.5 63 8.0 64 5.0 65 2.5 66 2.0 67 0.5 68 0.5 69 1.0 70 2.0 71 2.0 72 1.5 73 1.5 74 0.5 75 0.5 76 1.0 77 1.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.0125 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699599 spots for SRR3207811.sra Written 699599 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra Read 699591 spots for SRR3207811.sra Written 699591 spots for SRR3207811.sra SRR ids: ['SRR3207811.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bz4v80lw SRR3207811.sra spots: 13991828 blocks: [[1, 699591], [699592, 1399182], [1399183, 2098773], [2098774, 2798364], [2798365, 3497955], [3497956, 4197546], [4197547, 4897137], [4897138, 5596728], [5596729, 6296319], [6296320, 6995910], [6995911, 7695501], [7695502, 8395092], [8395093, 9094683], [9094684, 9794274], [9794275, 10493865], [10493866, 11193456], [11193457, 11893047], [11893048, 12592638], [12592639, 13292229], [13292230, 13991828]] SRR3207811 file size 3630449 SRR3207811 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207811 SRR3207811_1.fastq Input file: SRR3207811_1.fastq trimmed: SRR3207811-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 00:12:45 2025 >> started Tue Feb 11 00:12:52 2025 >> done (6.886s) 13991828 reads processed; of these: 1566 ( 0.01%) short reads filtered out after trimming by size control 4435 ( 0.03%) empty reads filtered out after trimming by size control 13985827 (99.96%) reads available; of these: 2728843 (19.51%) trimmed reads available after processing 11256984 (80.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 261 0.00% 19 347 0.00% 20 595 0.00% 21 581 0.00% 22 768 0.01% 23 1150 0.01% 24 1537 0.01% 25 1980 0.01% 26 1973 0.01% 27 1915 0.01% 28 1920 0.01% 29 2068 0.01% 30 2161 0.02% 31 2194 0.02% 32 2245 0.02% 33 2247 0.02% 34 2372 0.02% 35 2557 0.02% 36 2680 0.02% 37 2773 0.02% 38 2694 0.02% 39 2730 0.02% 40 2637 0.02% 41 2786 0.02% 42 2896 0.02% 43 2940 0.02% 44 3036 0.02% 45 3040 0.02% 46 3054 0.02% 47 2980 0.02% 48 3280 0.02% 49 3234 0.02% 50 3335 0.02% 51 3664 0.03% 52 3965 0.03% 53 4005 0.03% 54 3953 0.03% 55 4055 0.03% 56 4241 0.03% 57 4277 0.03% 58 4480 0.03% 59 4742 0.03% 60 4705 0.03% 61 4819 0.03% 62 5110 0.04% 63 5100 0.04% 64 5156 0.04% 65 5494 0.04% 66 5717 0.04% 67 6071 0.04% 68 6151 0.04% 69 6422 0.05% 70 6707 0.05% 71 6918 0.05% 72 7300 0.05% 73 7598 0.05% 74 7793 0.06% 75 8008 0.06% 76 5786 0.04% 77 6821 0.05% 78 8148 0.06% 79 8677 0.06% 80 9385 0.07% 81 10223 0.07% 82 11450 0.08% 83 13066 0.09% 84 13729 0.10% 85 15831 0.11% 86 18628 0.13% 87 23897 0.17% 88 33653 0.24% 89 69368 0.50% 90 235976 1.69% 91 102196 0.73% 92 416726 2.98% 93 88239 0.63% 94 239452 1.71% 95 141772 1.01% 96 391272 2.80% 97 130532 0.93% 98 351153 2.51% 99 173446 1.24% 100 11256984 80.49% 13985827 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=16.33 fanout-score-rank=13 prefix-density=0.12 prefix-fanout=16.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=10 fanout-score=238.88 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=26.3 sequence=TTCTTCTTCTTT Started job on | Feb 11 00:13:11 Started mapping on | Feb 11 00:13:11 Finished on | Feb 11 00:13:27 Mapping speed, Million of reads per hour | 3146.81 Number of input reads | 13985827 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 13374370 Uniquely mapped reads % | 95.63% Average mapped length | 97.98 Number of splices: Total | 3837277 Number of splices: Annotated (sjdb) | 3770054 Number of splices: GT/AG | 3780954 Number of splices: GC/AG | 46365 Number of splices: AT/AC | 3560 Number of splices: Non-canonical | 6398 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317742 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 225892 % of reads mapped to too many loci | 1.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 293715 293715 293715 N_multimapping 317742 317742 317742 N_noFeature 557616 6918951 6919747 N_ambiguous 137195 21686 22413 UnstrandedReadsAssigned:12679559 PositiveStrandReadsAssigned:6433733 NegativeStrandReadsAssigned:6432210 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207811 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207811-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,985,827 reads, 13,143,911 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR3207811.ke.tsv 34699 SRR3207811.se.tsv 87100 total ==> SRR3207811.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 341.455 20.235 Potri.005G024800.1.v4.1 1035 936 20 2.42996 Potri.004G059700.1.v4.1 961 862 7 0.923497 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 198.15 7.92335 Potri.016G087400.1.v4.1 270 171 618 410.996 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 56 3.80432 Potri.012G127500.1.v4.1 977 878 1302 168.64 ==> SRR3207811.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1603 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 218 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 26 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207811 completed mapping pipeline successfully