Starting /dee2/code/volunteer_pipeline.sh SRR3207812 current disk space = 3056960577536 free memory = 1577581000 SRR3207812 SRAfilesize f6d11e277fca893df1cbc40dff4256bd SRR3207812.sra SRR3207812.sra file validated SRR3207812 is single end SRR3207812 is conventional basespace SRR3207812 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207812_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.41375 40.0 38.0 40.0 33.0 40.0 2 37.51975 40.0 38.0 40.0 33.0 40.0 3 37.4475 40.0 38.0 40.0 33.0 40.0 4 37.4225 39.0 38.0 40.0 33.0 40.0 5 37.37825 40.0 38.0 40.0 33.0 40.0 6 37.4845 39.0 38.0 40.0 33.0 40.0 7 37.49475 39.0 38.0 40.0 33.0 40.0 8 37.4505 39.0 38.0 40.0 33.0 40.0 9 37.4255 39.0 38.0 40.0 33.0 40.0 10 37.417 39.0 38.0 40.0 33.0 40.0 11 37.81025 39.0 38.0 40.0 33.0 40.0 12 37.695 39.0 38.0 40.0 33.0 40.0 13 37.5795 39.0 38.0 40.0 33.0 40.0 14 37.68675 39.0 38.0 40.0 33.0 40.0 15 37.59975 39.0 38.0 40.0 33.0 40.0 16 37.6615 39.0 38.0 40.0 33.0 40.0 17 37.54125 39.0 38.0 40.0 33.0 40.0 18 37.53025 39.0 38.0 40.0 33.0 40.0 19 37.45175 39.0 38.0 40.0 33.0 40.0 20 37.374 39.0 38.0 40.0 33.0 40.0 21 37.381 39.0 38.0 40.0 33.0 40.0 22 37.36675 39.0 38.0 40.0 33.0 40.0 23 37.30675 39.0 37.0 40.0 33.0 40.0 24 37.09775 39.0 37.0 40.0 31.0 40.0 25 37.04625 39.0 36.0 40.0 31.0 40.0 26 37.08675 39.0 37.0 40.0 33.0 40.0 27 37.09425 39.0 37.0 40.0 32.0 40.0 28 37.0875 39.0 37.0 40.0 33.0 40.0 29 37.02275 39.0 36.0 40.0 32.0 40.0 30 36.95 39.0 36.0 40.0 32.0 40.0 31 36.814 39.0 36.0 40.0 31.0 40.0 32 36.71225 39.0 36.0 40.0 31.0 40.0 33 36.7655 39.0 36.0 40.0 31.0 40.0 34 36.72975 39.0 36.0 40.0 31.0 40.0 35 36.65125 39.0 36.0 40.0 31.0 40.0 36 36.66775 39.0 36.0 40.0 31.0 40.0 37 36.6705 39.0 36.0 40.0 31.0 40.0 38 36.5015 39.0 36.0 40.0 31.0 40.0 39 36.565 39.0 36.0 40.0 31.0 40.0 40 36.287 39.0 36.0 40.0 31.0 40.0 41 36.40525 39.0 36.0 40.0 31.0 40.0 42 36.14975 39.0 35.0 40.0 31.0 40.0 43 36.1255 39.0 36.0 40.0 31.0 40.0 44 36.02225 39.0 35.0 40.0 30.0 40.0 45 35.8665 39.0 35.0 40.0 30.0 40.0 46 35.92025 39.0 35.0 40.0 31.0 40.0 47 35.35475 38.0 35.0 39.0 29.0 40.0 48 35.651 38.0 35.0 39.0 30.0 40.0 49 35.49425 38.0 35.0 39.0 30.0 40.0 50 35.4845 38.0 35.0 39.0 30.0 40.0 51 35.2685 38.0 35.0 39.0 29.0 40.0 52 35.14075 38.0 35.0 39.0 29.0 40.0 53 35.022 38.0 34.0 39.0 29.0 40.0 54 34.8075 38.0 34.0 39.0 29.0 40.0 55 34.63375 38.0 34.0 39.0 28.0 40.0 56 34.579 38.0 34.0 39.0 29.0 40.0 57 34.3735 37.0 34.0 39.0 28.0 40.0 58 34.1175 37.0 33.0 39.0 27.0 40.0 59 33.7155 36.0 33.0 39.0 26.0 39.0 60 33.69875 36.0 33.0 39.0 25.0 39.0 61 33.701 36.0 33.0 39.0 26.0 40.0 62 33.47625 36.0 33.0 39.0 26.0 39.0 63 32.959 36.0 33.0 38.0 24.0 39.0 64 33.11625 36.0 33.0 38.0 24.0 39.0 65 33.17625 36.0 33.0 38.0 25.0 39.0 66 32.67425 36.0 33.0 38.0 23.0 39.0 67 32.341 36.0 32.0 38.0 23.0 39.0 68 31.70775 35.0 31.0 38.0 19.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 1.0 4 0.0 5 1.0 6 2.0 7 1.0 8 4.0 9 2.0 10 5.0 11 3.0 12 5.0 13 10.0 14 10.0 15 5.0 16 7.0 17 3.0 18 12.0 19 8.0 20 16.0 21 19.0 22 18.0 23 17.0 24 24.0 25 22.0 26 25.0 27 34.0 28 43.0 29 72.0 30 64.0 31 66.0 32 99.0 33 103.0 34 163.0 35 174.0 36 324.0 37 498.0 38 912.0 39 1204.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.108667859882384 15.36691383277934 16.389670161084123 43.134748146254154 2 17.4 25.15 38.725 18.725 3 21.075 28.775000000000002 27.525 22.625 4 24.575 33.0 20.25 22.175 5 23.575 36.6 23.1 16.725 6 18.05 37.175000000000004 24.6 20.175 7 17.25 16.975 44.875 20.9 8 19.950000000000003 23.5 28.925 27.625 9 19.950000000000003 23.95 31.125000000000004 24.975 10 20.474999999999998 38.574999999999996 24.275 16.675 11 25.474999999999998 28.000000000000004 20.325 26.200000000000003 12 21.175 24.4 29.65 24.775 13 20.45 28.175 29.525000000000002 21.85 14 20.525 27.825 29.15 22.5 15 19.85 28.050000000000004 29.725 22.375 16 22.1 27.55 29.025000000000002 21.325 17 22.6 27.925 26.924999999999997 22.55 18 21.05 29.549999999999997 27.725 21.675 19 20.625 28.675 27.325 23.375 20 21.175 27.55 28.4 22.875 21 21.825 28.1 27.900000000000002 22.175 22 22.1 27.800000000000004 28.375 21.725 23 21.55 28.4 28.575 21.475 24 21.55 28.1 27.775 22.575 25 21.73043260815204 27.581895473868467 26.981745436359088 23.705926481620406 26 21.660830415207606 28.96448224112056 27.03851925962982 22.336168084042022 27 21.25 28.599999999999998 26.724999999999998 23.425 28 21.0 27.474999999999998 29.425 22.1 29 20.724999999999998 28.825 27.6 22.85 30 21.4 27.075 29.65 21.875 31 22.375 28.825 27.125 21.675 32 20.849999999999998 30.049999999999997 26.25 22.85 33 21.0 27.675 28.549999999999997 22.775000000000002 34 21.65 28.299999999999997 28.000000000000004 22.05 35 22.35 28.425 28.025 21.2 36 21.075 28.499999999999996 28.549999999999997 21.875 37 22.325 28.050000000000004 27.975 21.65 38 21.975 29.75 27.400000000000002 20.875 39 21.275 27.625 27.6 23.5 40 21.55 29.9 27.450000000000003 21.099999999999998 41 21.775 30.425 26.275 21.525 42 21.4 29.725 26.724999999999998 22.15 43 22.2 27.375 27.6 22.825 44 22.725 28.975 27.375 20.925 45 21.8 28.175 29.599999999999998 20.424999999999997 46 21.7 28.275 28.975 21.05 47 21.925 28.349999999999998 28.499999999999996 21.224999999999998 48 21.2 28.7 27.55 22.55 49 21.425 28.875 27.425 22.275 50 22.325 28.599999999999998 26.950000000000003 22.125 51 22.25 27.075 28.725 21.95 52 22.650000000000002 26.775 27.400000000000002 23.175 53 19.75 29.599999999999998 28.275 22.375 54 20.575 28.7 28.325 22.400000000000002 55 20.599999999999998 28.299999999999997 28.525 22.575 56 20.95 26.775 29.975 22.3 57 21.349999999999998 28.95 27.625 22.075 58 23.275000000000002 28.999999999999996 26.575 21.15 59 21.775 28.249999999999996 28.375 21.6 60 21.125 27.775 27.3 23.799999999999997 61 22.650000000000002 28.325 27.700000000000003 21.325 62 21.875 27.900000000000002 27.775 22.45 63 20.599999999999998 28.9 28.95 21.55 64 22.225 28.199999999999996 27.525 22.05 65 22.05 29.65 26.825 21.475 66 21.125 28.625 28.4 21.85 67 23.05 28.125 27.224999999999998 21.6 68 22.45 28.275 28.4 20.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.5 19 3.0 20 5.0 21 8.5 22 10.0 23 7.5 24 6.5 25 8.0 26 12.5 27 25.0 28 33.0 29 37.5 30 48.5 31 55.0 32 68.5 33 89.0 34 96.0 35 109.5 36 157.0 37 191.0 38 206.5 39 261.0 40 318.5 41 337.0 42 338.5 43 357.0 44 374.0 45 367.0 46 326.5 47 293.0 48 287.0 49 249.0 50 217.0 51 192.5 52 153.0 53 138.0 54 113.5 55 79.0 56 69.0 57 52.5 58 33.5 59 31.0 60 25.5 61 17.0 62 14.0 63 11.5 64 9.0 65 8.0 66 7.0 67 6.0 68 3.0 69 1.0 70 1.5 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 1.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.025 26 0.05 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72396486825596 99.35000000000001 2 0.2258469259723965 0.44999999999999996 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.02509410288582183 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGAAAAA 5 0.125 TruSeq Adapter, Index 6 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10 0.075 0.0 0.0 0.0 0.0 11 0.075 0.0 0.0 0.0 0.0 12 0.075 0.0 0.0 0.0 0.0 13 0.075 0.0 0.0 0.0 0.0 14 0.075 0.0 0.0 0.0 0.0 15 0.075 0.0 0.0 0.0 0.0 16 0.075 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395414 spots for SRR3207812.sra Written 395414 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra Read 395408 spots for SRR3207812.sra Written 395408 spots for SRR3207812.sra SRR ids: ['SRR3207812.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n_31djyx SRR3207812.sra spots: 7908166 blocks: [[1, 395408], [395409, 790816], [790817, 1186224], [1186225, 1581632], [1581633, 1977040], [1977041, 2372448], [2372449, 2767856], [2767857, 3163264], [3163265, 3558672], [3558673, 3954080], [3954081, 4349488], [4349489, 4744896], [4744897, 5140304], [5140305, 5535712], [5535713, 5931120], [5931121, 6326528], [6326529, 6721936], [6721937, 7117344], [7117345, 7512752], [7512753, 7908166]] SRR3207812 file size 1652895 SRR3207812 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207812 SRR3207812_1.fastq Input file: SRR3207812_1.fastq trimmed: SRR3207812-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 01:27:22 2025 >> started Tue Feb 11 01:27:26 2025 >> done (3.634s) 7908166 reads processed; of these: 20830 ( 0.26%) short reads filtered out after trimming by size control 68515 ( 0.87%) empty reads filtered out after trimming by size control 7818821 (98.87%) reads available; of these: 372833 ( 4.77%) trimmed reads available after processing 7445988 (95.23%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1647 0.02% 19 2267 0.03% 20 4226 0.05% 21 1164 0.01% 22 1478 0.02% 23 2229 0.03% 24 3484 0.04% 25 6451 0.08% 26 1848 0.02% 27 1901 0.02% 28 2505 0.03% 29 3896 0.05% 30 6728 0.09% 31 1773 0.02% 32 2304 0.03% 33 2592 0.03% 34 4042 0.05% 35 7070 0.09% 36 1940 0.02% 37 2350 0.03% 38 3374 0.04% 39 5392 0.07% 40 10434 0.13% 41 2220 0.03% 42 2900 0.04% 43 4043 0.05% 44 6761 0.09% 45 13024 0.17% 46 2811 0.04% 47 3496 0.04% 48 5032 0.06% 49 8406 0.11% 50 15290 0.20% 51 3396 0.04% 52 4461 0.06% 53 6469 0.08% 54 10844 0.14% 55 22096 0.28% 56 4371 0.06% 57 5928 0.08% 58 8773 0.11% 59 15090 0.19% 60 35961 0.46% 61 5781 0.07% 62 7791 0.10% 63 11828 0.15% 64 20439 0.26% 65 39634 0.51% 66 6703 0.09% 67 18190 0.23% 68 7445988 95.23% 7818821 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=32 prefix-density=0.04 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=10 fanout-score=192.27 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=21.0 sequence=TTCTTCTTCTTC Started job on | Feb 11 01:27:40 Started mapping on | Feb 11 01:27:40 Finished on | Feb 11 01:27:47 Mapping speed, Million of reads per hour | 4021.11 Number of input reads | 7818821 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 7397399 Uniquely mapped reads % | 94.61% Average mapped length | 67.12 Number of splices: Total | 1386885 Number of splices: Annotated (sjdb) | 1364561 Number of splices: GT/AG | 1366358 Number of splices: GC/AG | 16800 Number of splices: AT/AC | 1625 Number of splices: Non-canonical | 2102 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 240809 % of reads mapped to multiple loci | 3.08% Number of reads mapped to too many loci | 137075 % of reads mapped to too many loci | 1.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 180613 180613 180613 N_multimapping 240809 240809 240809 N_noFeature 358587 3851669 3858622 N_ambiguous 70241 12236 12402 UnstrandedReadsAssigned:6968571 PositiveStrandReadsAssigned:3533494 NegativeStrandReadsAssigned:3526375 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207812 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207812-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,818,821 reads, 7,245,764 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR3207812.ke.tsv 34699 SRR3207812.se.tsv 87100 total ==> SRR3207812.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 218 23.5443 Potri.005G024800.1.v4.1 1035 936 41 9.07847 Potri.004G059700.1.v4.1 961 862 8 1.92348 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 99.9085 7.28077 Potri.016G087400.1.v4.1 270 171 281 340.577 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 32.5473 4.02962 Potri.012G127500.1.v4.1 977 878 655 154.615 ==> SRR3207812.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 895 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 124 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207812 completed mapping pipeline successfully