Starting /dee2/code/volunteer_pipeline.sh SRR3207813 current disk space = 3057124057088 free memory = 1506101396 SRR3207813 SRAfilesize a2b20abd1ce5b355fecca6fbf53d5704 SRR3207813.sra SRR3207813.sra file validated SRR3207813 is single end SRR3207813 is conventional basespace SRR3207813 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207813_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.43075 40.0 38.0 40.0 33.0 40.0 2 37.476 40.0 38.0 40.0 33.0 40.0 3 37.4855 40.0 38.0 40.0 33.0 40.0 4 37.53625 40.0 38.0 40.0 33.0 40.0 5 37.3705 40.0 38.0 40.0 33.0 40.0 6 37.57175 39.0 38.0 40.0 33.0 40.0 7 37.57175 40.0 38.0 40.0 33.0 40.0 8 37.54025 40.0 38.0 40.0 33.0 40.0 9 37.47725 39.0 38.0 40.0 33.0 40.0 10 37.533 39.0 38.0 40.0 33.0 40.0 11 37.9565 39.0 38.0 40.0 34.0 40.0 12 37.83225 39.0 38.0 40.0 33.0 40.0 13 37.7835 39.0 38.0 40.0 33.0 40.0 14 37.80175 39.0 38.0 40.0 33.0 40.0 15 37.732 39.0 38.0 40.0 33.0 40.0 16 37.7995 39.0 38.0 40.0 33.0 40.0 17 37.68375 39.0 38.0 40.0 33.0 40.0 18 37.61825 39.0 38.0 40.0 33.0 40.0 19 37.59025 39.0 38.0 40.0 33.0 40.0 20 37.47275 39.0 38.0 40.0 33.0 40.0 21 37.51925 39.0 38.0 40.0 33.0 40.0 22 37.53625 39.0 38.0 40.0 33.0 40.0 23 37.458 39.0 38.0 40.0 33.0 40.0 24 37.3115 39.0 37.0 40.0 33.0 40.0 25 37.19425 39.0 37.0 40.0 32.0 40.0 26 37.20175 39.0 37.0 40.0 33.0 40.0 27 37.26475 39.0 37.0 40.0 33.0 40.0 28 37.22925 39.0 37.0 40.0 33.0 40.0 29 37.17525 39.0 37.0 40.0 32.0 40.0 30 37.03275 39.0 37.0 40.0 32.0 40.0 31 37.02575 39.0 37.0 40.0 32.0 40.0 32 37.01475 39.0 36.0 40.0 32.0 40.0 33 36.99525 39.0 36.0 40.0 31.0 40.0 34 37.01975 39.0 37.0 40.0 32.0 40.0 35 36.873 39.0 36.0 40.0 31.0 40.0 36 36.86875 39.0 36.0 40.0 31.0 40.0 37 36.88725 39.0 36.0 40.0 31.0 40.0 38 36.6725 39.0 36.0 40.0 31.0 40.0 39 36.7235 39.0 36.0 40.0 31.0 40.0 40 36.45875 39.0 36.0 40.0 31.0 40.0 41 36.701 39.0 36.0 40.0 31.0 40.0 42 36.286 39.0 36.0 40.0 31.0 40.0 43 36.404 39.0 36.0 40.0 31.0 40.0 44 36.26575 39.0 36.0 40.0 31.0 40.0 45 36.035 39.0 36.0 40.0 31.0 40.0 46 36.041 39.0 36.0 40.0 31.0 40.0 47 35.4345 38.0 35.0 39.0 29.0 40.0 48 35.83325 39.0 35.0 40.0 30.0 40.0 49 35.612 38.0 35.0 39.0 29.0 40.0 50 35.62325 38.0 35.0 39.0 30.0 40.0 51 35.40425 38.0 35.0 39.0 30.0 40.0 52 35.34775 38.0 35.0 39.0 29.0 40.0 53 35.19075 38.0 35.0 39.0 29.0 40.0 54 34.87975 38.0 34.0 39.0 28.0 40.0 55 34.877 38.0 34.0 39.0 29.0 40.0 56 34.82975 38.0 34.0 39.0 29.0 40.0 57 34.66775 38.0 34.0 39.0 28.0 40.0 58 34.46975 37.0 34.0 39.0 28.0 40.0 59 34.03425 37.0 33.0 39.0 27.0 39.0 60 34.062 36.0 33.0 39.0 28.0 39.0 61 34.132 37.0 33.0 39.0 28.0 40.0 62 33.95825 36.0 33.0 39.0 28.0 39.0 63 33.26025 36.0 33.0 38.0 25.0 39.0 64 33.26225 36.0 33.0 38.0 25.0 39.0 65 33.381 36.0 33.0 38.0 26.0 39.0 66 32.82625 36.0 33.0 38.0 24.0 39.0 67 32.428 36.0 32.0 38.0 23.0 39.0 68 31.9045 35.0 31.0 38.0 21.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 0.0 4 0.0 5 2.0 6 4.0 7 3.0 8 5.0 9 4.0 10 1.0 11 7.0 12 5.0 13 5.0 14 7.0 15 5.0 16 9.0 17 7.0 18 11.0 19 13.0 20 10.0 21 13.0 22 22.0 23 18.0 24 18.0 25 21.0 26 26.0 27 31.0 28 60.0 29 55.0 30 46.0 31 67.0 32 73.0 33 106.0 34 159.0 35 205.0 36 282.0 37 490.0 38 939.0 39 1256.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.75602255253716 13.941568426447976 19.759097898513584 40.54331112250128 2 18.65 24.5 36.525 20.325 3 22.625 28.449999999999996 26.8 22.125 4 26.05 32.275 19.3 22.375 5 25.775 35.3 21.575 17.349999999999998 6 18.5 37.05 23.5 20.95 7 16.225 18.224999999999998 43.875 21.675 8 20.525 23.400000000000002 27.85 28.225 9 19.85 24.025 29.775000000000002 26.35 10 19.8 39.25 22.725 18.224999999999998 11 25.6 27.55 20.599999999999998 26.25 12 21.224999999999998 24.875 29.475 24.425 13 19.25 27.825 31.574999999999996 21.349999999999998 14 20.1 28.4 29.375 22.125 15 21.2 27.55 27.975 23.275000000000002 16 21.55 28.075 27.675 22.7 17 23.3 27.05 27.750000000000004 21.9 18 20.65 28.175 28.799999999999997 22.375 19 21.125 27.35 29.225 22.3 20 22.55 26.650000000000002 28.15 22.650000000000002 21 22.475 27.700000000000003 27.6 22.225 22 21.75 29.275000000000002 26.275 22.7 23 22.875 28.7 26.1 22.325 24 22.725 28.549999999999997 27.025 21.7 25 20.625 28.725 28.175 22.475 26 21.55 28.349999999999998 27.925 22.175 27 21.4 26.450000000000003 27.950000000000003 24.2 28 20.349999999999998 29.299999999999997 27.975 22.375 29 22.375 28.025 27.975 21.625 30 22.25 27.05 28.9 21.8 31 20.9 28.1 29.25 21.75 32 22.125 28.775000000000002 28.075 21.025 33 20.849999999999998 27.55 28.15 23.45 34 21.5 27.825 28.975 21.7 35 21.85 28.375 27.250000000000004 22.525000000000002 36 22.25 28.375 27.525 21.85 37 22.425 29.175 27.625 20.775 38 22.400000000000002 28.599999999999998 27.425 21.575 39 21.625 27.900000000000002 27.075 23.400000000000002 40 21.4 28.475 27.800000000000004 22.325 41 22.625 28.325 27.625 21.425 42 22.025 27.375 28.475 22.125 43 22.15 28.15 28.65 21.05 44 22.125 27.925 28.349999999999998 21.6 45 21.95 28.349999999999998 27.750000000000004 21.95 46 21.425 26.650000000000002 29.825000000000003 22.1 47 22.5 27.0 28.299999999999997 22.2 48 21.875 29.15 28.425 20.549999999999997 49 22.475 28.249999999999996 27.975 21.3 50 21.95 27.975 27.975 22.1 51 22.5 28.625 27.750000000000004 21.125 52 22.3 28.7 27.0 22.0 53 20.95 28.125 28.525 22.400000000000002 54 21.65 28.000000000000004 28.199999999999996 22.15 55 21.375 28.4 28.275 21.95 56 20.200000000000003 29.5 28.15 22.15 57 20.875 29.5 27.250000000000004 22.375 58 21.175 27.450000000000003 29.25 22.125 59 22.875 27.85 27.500000000000004 21.775 60 20.75 28.025 28.999999999999996 22.225 61 20.65 28.325 28.225 22.8 62 22.025 28.299999999999997 28.199999999999996 21.475 63 22.75 27.825 27.200000000000003 22.225 64 21.525 28.999999999999996 28.325 21.15 65 22.15 29.099999999999998 28.175 20.575 66 20.8 29.7 28.349999999999998 21.15 67 21.875 28.225 27.925 21.975 68 22.35 28.599999999999998 27.125 21.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 4.5 22 8.0 23 7.0 24 9.5 25 13.0 26 14.5 27 25.5 28 35.0 29 38.5 30 44.5 31 47.0 32 67.0 33 103.0 34 119.0 35 120.0 36 155.5 37 190.0 38 206.0 39 242.0 40 280.0 41 298.0 42 315.0 43 340.5 44 349.0 45 351.5 46 344.5 47 335.0 48 309.5 49 260.5 50 237.0 51 217.0 52 177.0 53 157.0 54 125.5 55 79.5 56 65.0 57 48.5 58 30.0 59 28.0 60 21.5 61 15.0 62 15.0 63 14.5 64 11.0 65 5.0 66 2.0 67 2.0 68 3.0 69 4.0 70 3.5 71 2.5 72 2.0 73 1.5 74 1.5 75 2.0 76 1.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82394366197182 99.225 2 0.12575452716297786 0.25 3 0.0 0.0 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025150905432595575 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAA 17 0.42500000000000004 TruSeq Adapter, Index 7 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10 0.125 0.0 0.0 0.0 0.0 11 0.125 0.0 0.0 0.0 0.0 12 0.125 0.0 0.0 0.0 0.0 13 0.125 0.0 0.0 0.0 0.0 14 0.125 0.0 0.0 0.0 0.0 15 0.125 0.0 0.0 0.0 0.0 16 0.125 0.0 0.0 0.0 0.0 17 0.125 0.0 0.0 0.0 0.0 18 0.125 0.0 0.0 0.0 0.0 19 0.125 0.0 0.0 0.0 0.0 20 0.125 0.0 0.0 0.0 0.0 21 0.125 0.0 0.0 0.0 0.0 22 0.125 0.0 0.0 0.0 0.0 23 0.125 0.0 0.0 0.0 0.0 24 0.125 0.0 0.0 0.0 0.0 25 0.125 0.0 0.0 0.0 0.0 26 0.125 0.0 0.0 0.0 0.0 27 0.125 0.0 0.0 0.0 0.0 28 0.125 0.0 0.0 0.0 0.0 29 0.125 0.0 0.0 0.0 0.0 30 0.125 0.0 0.0 0.0 0.0 31 0.125 0.0 0.0 0.0 0.0 32 0.125 0.0 0.0 0.0 0.0 33 0.125 0.0 0.0 0.0 0.0 34 0.125 0.0 0.0 0.0 0.0 35 0.125 0.0 0.0 0.0 0.0 36 0.125 0.0 0.0 0.0 0.0 37 0.125 0.0 0.0 0.0 0.0 38 0.125 0.0 0.0 0.0 0.0 39 0.125 0.0 0.0 0.0 0.0 40 0.125 0.0 0.0 0.0 0.0 41 0.125 0.0 0.0 0.0 0.0 42 0.125 0.0 0.0 0.0 0.0 43 0.125 0.0 0.0 0.0 0.0 44 0.125 0.0 0.0 0.0 0.0 45 0.125 0.0 0.0 0.0 0.0 46 0.125 0.0 0.0 0.0 0.0 47 0.125 0.0 0.0 0.0 0.0 48 0.125 0.0 0.0 0.0 0.0 49 0.125 0.0 0.0 0.0 0.0 50 0.125 0.0 0.0 0.0 0.0 51 0.125 0.0 0.0 0.0 0.0 52 0.125 0.0 0.0 0.0 0.0 53 0.125 0.0 0.0 0.0 0.0 54 0.125 0.0 0.0 0.0 0.0 55 0.125 0.0 0.0 0.0 0.0 56 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452937 spots for SRR3207813.sra Written 452937 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra Read 452934 spots for SRR3207813.sra Written 452934 spots for SRR3207813.sra SRR ids: ['SRR3207813.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bl_vzrot SRR3207813.sra spots: 9058683 blocks: [[1, 452934], [452935, 905868], [905869, 1358802], [1358803, 1811736], [1811737, 2264670], [2264671, 2717604], [2717605, 3170538], [3170539, 3623472], [3623473, 4076406], [4076407, 4529340], [4529341, 4982274], [4982275, 5435208], [5435209, 5888142], [5888143, 6341076], [6341077, 6794010], [6794011, 7246944], [7246945, 7699878], [7699879, 8152812], [8152813, 8605746], [8605747, 9058683]] SRR3207813 file size 1893529 SRR3207813 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207813 SRR3207813_1.fastq Input file: SRR3207813_1.fastq trimmed: SRR3207813-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 01:08:35 2025 >> started Tue Feb 11 01:08:40 2025 >> done (4.682s) 9058683 reads processed; of these: 21801 ( 0.24%) short reads filtered out after trimming by size control 95246 ( 1.05%) empty reads filtered out after trimming by size control 8941636 (98.71%) reads available; of these: 417418 ( 4.67%) trimmed reads available after processing 8524218 (95.33%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1836 0.02% 19 2624 0.03% 20 4752 0.05% 21 1329 0.01% 22 1748 0.02% 23 2511 0.03% 24 3960 0.04% 25 7494 0.08% 26 1986 0.02% 27 2168 0.02% 28 2889 0.03% 29 4428 0.05% 30 7768 0.09% 31 2169 0.02% 32 2572 0.03% 33 2904 0.03% 34 4468 0.05% 35 7810 0.09% 36 2152 0.02% 37 2720 0.03% 38 3645 0.04% 39 6074 0.07% 40 11475 0.13% 41 2495 0.03% 42 3240 0.04% 43 4606 0.05% 44 7718 0.09% 45 14450 0.16% 46 3074 0.03% 47 3937 0.04% 48 5650 0.06% 49 9546 0.11% 50 17230 0.19% 51 3722 0.04% 52 4882 0.05% 53 7245 0.08% 54 12030 0.13% 55 24632 0.28% 56 4734 0.05% 57 6435 0.07% 58 9865 0.11% 59 16929 0.19% 60 40413 0.45% 61 6470 0.07% 62 8642 0.10% 63 13092 0.15% 64 22445 0.25% 65 44565 0.50% 66 7546 0.08% 67 20343 0.23% 68 8524218 95.33% 8941636 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=5.23 fanout-score-rank=19 prefix-density=0.05 prefix-fanout=4.3 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=13 fanout-score=106.99 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.1 sequence=CCACCACCAACA Started job on | Feb 11 01:08:52 Started mapping on | Feb 11 01:08:52 Finished on | Feb 11 01:09:03 Mapping speed, Million of reads per hour | 2926.35 Number of input reads | 8941636 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 8452791 Uniquely mapped reads % | 94.53% Average mapped length | 67.13 Number of splices: Total | 1555303 Number of splices: Annotated (sjdb) | 1530135 Number of splices: GT/AG | 1532876 Number of splices: GC/AG | 18374 Number of splices: AT/AC | 1719 Number of splices: Non-canonical | 2334 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 273610 % of reads mapped to multiple loci | 3.06% Number of reads mapped to too many loci | 163823 % of reads mapped to too many loci | 1.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.57% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 215235 215235 215235 N_multimapping 273610 273610 273610 N_noFeature 393329 4384520 4397452 N_ambiguous 91622 13418 14144 UnstrandedReadsAssigned:7967840 PositiveStrandReadsAssigned:4054853 NegativeStrandReadsAssigned:4041195 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207813 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207813-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,941,636 reads, 8,304,567 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR3207813.ke.tsv 34699 SRR3207813.se.tsv 87100 total ==> SRR3207813.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 248 23.2856 Potri.005G024800.1.v4.1 1035 936 33 6.35256 Potri.004G059700.1.v4.1 961 862 3.58764 0.749916 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 126.395 8.00779 Potri.016G087400.1.v4.1 270 171 309 325.592 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 35.6007 3.8319 Potri.012G127500.1.v4.1 977 878 782 160.481 ==> SRR3207813.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1077 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 148 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207813 completed mapping pipeline successfully