Starting /dee2/code/volunteer_pipeline.sh SRR3207814 current disk space = 3057332273152 free memory = 1203391164 SRR3207814 SRAfilesize eb4a13031129293439a1f7c0a23afbe4 SRR3207814.sra SRR3207814.sra file validated SRR3207814 is single end SRR3207814 is conventional basespace SRR3207814 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207814_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.79775 40.0 38.0 40.0 33.0 40.0 2 37.7275 40.0 38.0 40.0 33.0 40.0 3 37.71625 40.0 38.0 40.0 33.0 40.0 4 37.681 40.0 38.0 40.0 33.0 40.0 5 37.67725 40.0 38.0 40.0 33.0 40.0 6 37.75075 40.0 38.0 40.0 33.0 40.0 7 37.7795 40.0 38.0 40.0 33.0 40.0 8 37.72475 40.0 38.0 40.0 33.0 40.0 9 37.76375 40.0 38.0 40.0 33.0 40.0 10 37.69725 40.0 38.0 40.0 33.0 40.0 11 38.02775 40.0 38.0 40.0 35.0 40.0 12 37.81075 39.0 38.0 40.0 33.0 40.0 13 37.72675 39.0 38.0 40.0 33.0 40.0 14 37.8635 39.0 38.0 40.0 33.0 40.0 15 37.744 39.0 38.0 40.0 33.0 40.0 16 37.7775 39.0 38.0 40.0 33.0 40.0 17 37.653 39.0 38.0 40.0 33.0 40.0 18 37.68 39.0 38.0 40.0 33.0 40.0 19 37.607 39.0 38.0 40.0 33.0 40.0 20 37.55825 39.0 38.0 40.0 33.0 40.0 21 37.57875 39.0 38.0 40.0 33.0 40.0 22 37.51275 39.0 38.0 40.0 33.0 40.0 23 37.475 39.0 38.0 40.0 33.0 40.0 24 37.3585 39.0 38.0 40.0 33.0 40.0 25 37.21975 39.0 37.0 40.0 33.0 40.0 26 37.15475 39.0 37.0 40.0 33.0 40.0 27 37.2975 39.0 38.0 40.0 33.0 40.0 28 37.192 39.0 37.0 40.0 33.0 40.0 29 37.2195 39.0 37.0 40.0 33.0 40.0 30 37.03475 39.0 37.0 40.0 32.0 40.0 31 36.95225 39.0 37.0 40.0 32.0 40.0 32 36.9975 39.0 37.0 40.0 32.0 40.0 33 36.91725 39.0 37.0 40.0 32.0 40.0 34 36.92775 39.0 37.0 40.0 31.0 40.0 35 36.856 39.0 37.0 40.0 31.0 40.0 36 36.803 39.0 36.0 40.0 32.0 40.0 37 36.84875 39.0 36.0 40.0 32.0 40.0 38 36.6075 39.0 36.0 40.0 31.0 40.0 39 36.66775 39.0 36.0 40.0 31.0 40.0 40 36.505 39.0 36.0 40.0 31.0 40.0 41 36.6575 39.0 36.0 40.0 32.0 40.0 42 36.4235 39.0 36.0 40.0 31.0 40.0 43 36.426 39.0 36.0 40.0 31.0 40.0 44 36.30925 39.0 36.0 40.0 31.0 40.0 45 36.22325 39.0 36.0 40.0 31.0 40.0 46 36.2095 39.0 36.0 40.0 31.0 40.0 47 35.6605 38.0 35.0 40.0 29.0 40.0 48 35.9765 39.0 35.0 40.0 30.0 40.0 49 35.85375 38.0 35.0 40.0 30.0 40.0 50 35.78575 38.0 35.0 40.0 30.0 40.0 51 35.6495 38.0 35.0 39.0 30.0 40.0 52 35.4935 38.0 35.0 39.0 29.0 40.0 53 35.4105 38.0 35.0 39.0 29.0 40.0 54 35.2355 38.0 35.0 39.0 29.0 40.0 55 35.12925 38.0 35.0 39.0 29.0 40.0 56 35.127 38.0 35.0 39.0 29.0 40.0 57 34.90475 38.0 34.0 39.0 29.0 40.0 58 34.73525 38.0 34.0 39.0 28.0 40.0 59 34.3255 37.0 33.0 39.0 27.0 40.0 60 34.33725 37.0 33.0 39.0 27.0 40.0 61 34.3995 38.0 34.0 39.0 28.0 40.0 62 34.11325 37.0 33.0 39.0 27.0 40.0 63 33.50425 36.0 33.0 39.0 26.0 39.0 64 33.723 36.0 33.0 39.0 27.0 39.0 65 33.6735 36.0 33.0 39.0 27.0 39.0 66 33.335 36.0 33.0 39.0 26.0 39.0 67 32.95625 36.0 33.0 38.0 24.0 39.0 68 32.39525 36.0 32.0 38.0 23.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 0.0 4 0.0 5 1.0 6 3.0 7 2.0 8 2.0 9 2.0 10 5.0 11 7.0 12 4.0 13 9.0 14 4.0 15 11.0 16 1.0 17 11.0 18 10.0 19 9.0 20 7.0 21 15.0 22 20.0 23 10.0 24 14.0 25 22.0 26 24.0 27 39.0 28 49.0 29 52.0 30 52.0 31 68.0 32 67.0 33 105.0 34 155.0 35 195.0 36 289.0 37 436.0 38 877.0 39 1404.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.626106754363775 14.596508980521122 19.175309891221858 40.602074373893245 2 19.55 26.275 35.575 18.6 3 21.75 30.425 27.275 20.549999999999997 4 24.375 33.6 19.75 22.275 5 24.8 34.775 23.325000000000003 17.1 6 18.05 38.0 24.375 19.575 7 15.275 16.400000000000002 46.550000000000004 21.775 8 20.474999999999998 22.375 28.725 28.425 9 21.375 22.900000000000002 29.95 25.775 10 18.95 39.525 23.799999999999997 17.724999999999998 11 25.775 25.900000000000002 21.224999999999998 27.1 12 21.825 23.599999999999998 28.7 25.874999999999996 13 19.75 29.625 28.95 21.675 14 21.525 27.250000000000004 29.299999999999997 21.925 15 20.825 28.325 28.9 21.95 16 22.375 28.225 27.250000000000004 22.15 17 23.150000000000002 27.975 26.674999999999997 22.2 18 22.25 29.525000000000002 27.025 21.2 19 20.349999999999998 28.625 28.249999999999996 22.775000000000002 20 23.25 28.325 27.950000000000003 20.474999999999998 21 21.675 27.775 27.425 23.125 22 20.325 29.825000000000003 27.35 22.5 23 22.7 28.599999999999998 27.625 21.075 24 21.025 29.849999999999998 27.250000000000004 21.875 25 21.655413853463365 27.181795448862218 28.232058014503625 22.930732683170792 26 22.255563890972745 28.95723930982746 26.531632908227053 22.255563890972745 27 21.825 28.625 27.625 21.925 28 20.825 28.875 28.125 22.175 29 21.6 29.049999999999997 27.275 22.075 30 21.5 28.65 27.275 22.575 31 20.349999999999998 27.450000000000003 29.2 23.0 32 20.3 29.049999999999997 27.625 23.025000000000002 33 22.225 28.1 28.549999999999997 21.125 34 21.625 29.325000000000003 27.400000000000002 21.65 35 22.2 28.375 27.450000000000003 21.975 36 21.075 28.725 27.400000000000002 22.8 37 21.175 28.925 27.500000000000004 22.400000000000002 38 21.825 28.525 27.250000000000004 22.400000000000002 39 21.875 27.3 28.125 22.7 40 22.5 27.525 27.35 22.625 41 21.125 28.349999999999998 28.475 22.05 42 20.9 28.525 28.425 22.15 43 21.775 27.025 28.65 22.55 44 22.25 27.55 27.700000000000003 22.5 45 21.925 27.500000000000004 29.675 20.9 46 21.75 28.125 28.000000000000004 22.125 47 21.6 28.999999999999996 27.025 22.375 48 22.0 29.575000000000003 25.974999999999998 22.45 49 21.425 28.299999999999997 28.925 21.349999999999998 50 22.15 28.050000000000004 27.875 21.925 51 21.075 28.575 28.725 21.625 52 21.8 26.950000000000003 28.925 22.325 53 22.05 27.975 28.15 21.825 54 21.725 28.225 27.925 22.125 55 21.575 29.15 26.950000000000003 22.325 56 21.25 27.55 29.025000000000002 22.175 57 21.325 28.15 29.025000000000002 21.5 58 21.625 27.775 28.725 21.875 59 22.175 28.65 27.500000000000004 21.675 60 20.674999999999997 27.900000000000002 29.175 22.25 61 20.95 27.800000000000004 28.825 22.425 62 22.45 27.875 28.225 21.45 63 22.175 27.925 27.800000000000004 22.1 64 22.6 27.625 27.900000000000002 21.875 65 21.099999999999998 27.750000000000004 28.299999999999997 22.85 66 21.475 29.95 28.1 20.474999999999998 67 21.725 27.500000000000004 28.975 21.8 68 23.0 28.15 27.175 21.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 1.0 19 2.0 20 2.5 21 5.5 22 8.0 23 6.5 24 8.5 25 12.0 26 14.0 27 23.0 28 30.0 29 36.5 30 49.5 31 56.0 32 61.5 33 82.5 34 98.0 35 119.5 36 162.0 37 183.0 38 201.5 39 255.5 40 311.5 41 332.0 42 334.5 43 351.0 44 365.0 45 351.5 46 332.0 47 326.0 48 303.5 49 257.0 50 233.0 51 208.0 52 151.5 53 120.0 54 113.0 55 85.5 56 65.0 57 49.0 58 30.0 59 27.0 60 26.0 61 19.5 62 14.0 63 14.5 64 11.5 65 5.5 66 3.0 67 3.5 68 4.0 69 4.0 70 3.0 71 1.0 72 0.0 73 0.0 74 0.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.025 26 0.025 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227367 spots for SRR3207814.sra Written 227367 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra Read 227361 spots for SRR3207814.sra Written 227361 spots for SRR3207814.sra SRR ids: ['SRR3207814.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xigm32l6 SRR3207814.sra spots: 4547226 blocks: [[1, 227361], [227362, 454722], [454723, 682083], [682084, 909444], [909445, 1136805], [1136806, 1364166], [1364167, 1591527], [1591528, 1818888], [1818889, 2046249], [2046250, 2273610], [2273611, 2500971], [2500972, 2728332], [2728333, 2955693], [2955694, 3183054], [3183055, 3410415], [3410416, 3637776], [3637777, 3865137], [3865138, 4092498], [4092499, 4319859], [4319860, 4547226]] SRR3207814 file size 949962 SRR3207814 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207814 SRR3207814_1.fastq Input file: SRR3207814_1.fastq trimmed: SRR3207814-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 00:23:30 2025 >> started Tue Feb 11 00:23:32 2025 >> done (2.159s) 4547226 reads processed; of these: 11011 ( 0.24%) short reads filtered out after trimming by size control 34810 ( 0.77%) empty reads filtered out after trimming by size control 4501405 (98.99%) reads available; of these: 207160 ( 4.60%) trimmed reads available after processing 4294245 (95.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 918 0.02% 19 1241 0.03% 20 2351 0.05% 21 659 0.01% 22 874 0.02% 23 1197 0.03% 24 2014 0.04% 25 3770 0.08% 26 979 0.02% 27 1065 0.02% 28 1387 0.03% 29 2148 0.05% 30 3889 0.09% 31 968 0.02% 32 1312 0.03% 33 1461 0.03% 34 2220 0.05% 35 3957 0.09% 36 1102 0.02% 37 1301 0.03% 38 1760 0.04% 39 3063 0.07% 40 5638 0.13% 41 1261 0.03% 42 1561 0.03% 43 2313 0.05% 44 3785 0.08% 45 7364 0.16% 46 1545 0.03% 47 1945 0.04% 48 2797 0.06% 49 4722 0.10% 50 8508 0.19% 51 1866 0.04% 52 2423 0.05% 53 3541 0.08% 54 6035 0.13% 55 12052 0.27% 56 2377 0.05% 57 3233 0.07% 58 4793 0.11% 59 8486 0.19% 60 19982 0.44% 61 3193 0.07% 62 4305 0.10% 63 6484 0.14% 64 11296 0.25% 65 22091 0.49% 66 3783 0.08% 67 10145 0.23% 68 4294245 95.40% 4501405 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=32 prefix-density=0.05 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=16 fanout-score=111.20 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.4 sequence=CCACCACCAACA Started job on | Feb 11 00:23:53 Started mapping on | Feb 11 00:23:53 Finished on | Feb 11 00:23:58 Mapping speed, Million of reads per hour | 3241.01 Number of input reads | 4501405 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 4281344 Uniquely mapped reads % | 95.11% Average mapped length | 67.13 Number of splices: Total | 806670 Number of splices: Annotated (sjdb) | 794278 Number of splices: GT/AG | 795200 Number of splices: GC/AG | 9369 Number of splices: AT/AC | 936 Number of splices: Non-canonical | 1165 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 136945 % of reads mapped to multiple loci | 3.04% Number of reads mapped to too many loci | 59413 % of reads mapped to too many loci | 1.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 83116 83116 83116 N_multimapping 136945 136945 136945 N_noFeature 186393 2222979 2215545 N_ambiguous 41971 6267 6525 UnstrandedReadsAssigned:4052980 PositiveStrandReadsAssigned:2052098 NegativeStrandReadsAssigned:2059274 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207814 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207814-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,501,405 reads, 4,202,458 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR3207814.ke.tsv 34699 SRR3207814.se.tsv 87100 total ==> SRR3207814.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 106 20.04 Potri.005G024800.1.v4.1 1035 936 7 2.71324 Potri.004G059700.1.v4.1 961 862 5 2.1044 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 72.5075 9.24953 Potri.016G087400.1.v4.1 270 171 164 347.948 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 17 3.68434 Potri.012G127500.1.v4.1 977 878 335 138.426 ==> SRR3207814.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 425 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 54 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207814 completed mapping pipeline successfully