Starting /dee2/code/volunteer_pipeline.sh SRR3207815 current disk space = 3057335242752 free memory = 1380485444 SRR3207815 SRAfilesize 1eb8f13658ffb4c8d343c32da3102e8d SRR3207815.sra SRR3207815.sra file validated SRR3207815 is single end SRR3207815 is conventional basespace SRR3207815 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207815_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.985 34.0 31.0 34.0 31.0 34.0 2 33.11975 34.0 33.0 34.0 31.0 34.0 3 33.231 34.0 34.0 34.0 31.0 34.0 4 36.533 37.0 37.0 37.0 35.0 37.0 5 36.51475 37.0 37.0 37.0 35.0 37.0 6 36.47075 37.0 37.0 37.0 35.0 37.0 7 36.47875 37.0 37.0 37.0 35.0 37.0 8 36.467 37.0 37.0 37.0 35.0 37.0 9 38.268 39.0 39.0 39.0 37.0 39.0 10-11 38.13175 39.0 39.0 39.0 36.0 39.0 12-13 38.17475 39.0 39.0 39.0 37.0 39.0 14-15 39.741 41.0 40.0 41.0 37.0 41.0 16-17 39.763875 41.0 40.0 41.0 37.5 41.0 18-19 39.693875 41.0 40.0 41.0 37.0 41.0 20-21 39.677125000000004 41.0 40.0 41.0 37.0 41.0 22-23 39.638625000000005 41.0 40.0 41.0 37.0 41.0 24-25 39.62225 41.0 40.0 41.0 37.0 41.0 26-27 39.439875 41.0 39.5 41.0 36.5 41.0 28-29 39.233875 41.0 39.0 41.0 36.0 41.0 30-31 38.814875 40.0 39.0 41.0 34.5 41.0 32-33 39.017375 40.5 39.0 41.0 35.5 41.0 34-35 39.2 41.0 39.0 41.0 36.0 41.0 36-37 39.290375 41.0 39.5 41.0 36.0 41.0 38-39 38.917625 40.5 38.5 41.0 35.0 41.0 40-41 38.942625 40.0 39.0 41.0 35.0 41.0 42-43 38.789500000000004 40.0 38.5 41.0 35.0 41.0 44-45 38.792249999999996 40.0 39.0 41.0 35.0 41.0 46-47 38.71725 40.5 38.5 41.0 34.5 41.0 48-49 38.7455 40.0 39.0 41.0 35.0 41.0 50-51 38.676249999999996 40.0 38.5 41.0 35.0 41.0 52-53 38.601875 40.0 38.5 41.0 35.0 41.0 54-55 38.079625 40.0 38.0 41.0 33.5 41.0 56-57 38.151 40.0 38.0 41.0 34.0 41.0 58-59 37.93725 40.0 37.5 41.0 33.5 41.0 60-61 37.47525 39.5 36.5 41.0 32.0 41.0 62-63 37.283 39.0 36.0 41.0 32.0 41.0 64-65 37.09375 39.0 36.0 41.0 32.5 41.0 66-67 36.440375 38.5 35.0 40.0 31.5 41.0 68-69 36.128125 37.5 35.0 40.0 31.0 41.0 70-71 35.66825 37.0 35.0 39.5 31.0 41.0 72-73 35.32275 36.5 35.0 39.0 31.0 40.5 74-75 34.897499999999994 36.0 35.0 39.0 31.0 40.0 76-77 33.942375 35.0 33.5 37.0 29.5 39.0 78-79 34.082125000000005 35.0 34.0 37.0 30.0 39.0 80-81 33.562 35.0 34.0 36.5 29.0 38.5 82-83 33.172875 35.0 34.0 36.0 29.0 37.0 84-85 33.0445 35.0 34.0 36.0 29.0 37.0 86-87 32.937124999999995 35.0 34.0 35.0 29.0 36.5 88-89 32.526375 35.0 33.5 35.0 28.0 36.0 90-91 32.3915 35.0 33.5 35.0 28.0 36.0 92-93 32.227999999999994 35.0 33.0 35.0 28.5 35.5 94-95 32.104124999999996 35.0 33.0 35.0 27.5 35.0 96-97 31.210875 34.0 32.0 35.0 25.0 35.0 98-99 31.366374999999998 34.5 33.0 35.0 25.0 35.0 100 31.277 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 4.0 11 0.0 12 5.0 13 6.0 14 8.0 15 5.0 16 4.0 17 9.0 18 8.0 19 5.0 20 9.0 21 7.0 22 12.0 23 10.0 24 14.0 25 10.0 26 22.0 27 27.0 28 31.0 29 38.0 30 54.0 31 51.0 32 71.0 33 83.0 34 136.0 35 194.0 36 324.0 37 873.0 38 1624.0 39 354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.8 16.225 14.124999999999998 42.85 2 18.625 25.074999999999996 38.775 17.525 3 20.730182545636406 28.057014253563388 27.881970492623154 23.330832708177045 4 23.0 34.625 20.9 21.475 5 23.599999999999998 35.675000000000004 23.125 17.599999999999998 6 17.65 37.025000000000006 25.224999999999998 20.1 7 16.150000000000002 18.575 43.974999999999994 21.3 8 18.675 23.724999999999998 30.7 26.900000000000002 9 20.825 22.900000000000002 32.65 23.625 10-11 22.4625 34.050000000000004 22.787499999999998 20.7 12-13 19.925 26.2625 30.375000000000004 23.4375 14-15 21.155288822205552 28.469617404351087 28.257064266066518 22.118029507376843 16-17 21.637500000000003 29.275000000000002 27.474999999999998 21.6125 18-19 22.125 28.462500000000002 27.575 21.837500000000002 20-21 20.8875 28.875 28.375 21.8625 22-23 21.3875 28.487499999999997 27.8375 22.287499999999998 24-25 21.7375 28.925 27.500000000000004 21.837500000000002 26-27 20.9 30.0875 28.4 20.6125 28-29 21.8 28.325 28.037499999999998 21.837500000000002 30-31 21.05 28.012500000000003 28.999999999999996 21.9375 32-33 21.6 28.325 28.0625 22.0125 34-35 21.224999999999998 28.775000000000002 27.775 22.225 36-37 21.375 29.012500000000003 26.825 22.787499999999998 38-39 21.875 28.787499999999998 27.825 21.512500000000003 40-41 22.400000000000002 28.9875 27.55 21.0625 42-43 22.162499999999998 28.025 27.6875 22.125 44-45 22.6 28.050000000000004 27.525 21.825 46-47 21.762500000000003 28.6625 28.487499999999997 21.087500000000002 48-49 22.125 27.900000000000002 27.8375 22.1375 50-51 21.91797949487372 29.069767441860467 27.644411102775695 21.36784196049012 52-53 21.4705514567963 29.823683881455548 27.447792922345883 21.257971739402276 54-55 21.512500000000003 28.875 27.6125 22.0 56-57 21.837500000000002 28.775000000000002 27.737499999999997 21.65 58-59 22.475 27.8125 27.474999999999998 22.237499999999997 60-61 21.325 28.749999999999996 28.4 21.525 62-63 22.1375 28.5875 27.950000000000003 21.325 64-65 21.8625 28.575 28.287499999999998 21.275 66-67 21.087500000000002 28.9875 28.199999999999996 21.725 68-69 21.075 29.349999999999998 28.375 21.2 70-71 22.5 28.825 28.249999999999996 20.424999999999997 72-73 22.237499999999997 27.750000000000004 28.287499999999998 21.725 74-75 21.625 28.3125 27.987499999999997 22.075 76-77 21.15 28.3125 28.3125 22.225 78-79 21.4 27.875 29.075 21.65 80-81 21.712500000000002 28.475 27.725 22.0875 82-83 21.15 29.212500000000002 27.775 21.8625 84-85 21.912499999999998 28.349999999999998 28.275 21.462500000000002 86-87 21.125 28.349999999999998 28.762500000000003 21.762500000000003 88-89 21.6125 28.449999999999996 28.125 21.8125 90-91 21.9375 27.775 28.325 21.9625 92-93 22.1 28.9 27.700000000000003 21.3 94-95 22.325 28.175 28.262500000000003 21.2375 96-97 22.162499999999998 28.549999999999997 28.3625 20.925 98-99 23.2625 28.175 27.325 21.2375 100 23.05 27.925 28.075 20.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 1.5 24 1.5 25 3.0 26 6.0 27 11.0 28 13.5 29 16.5 30 21.5 31 32.5 32 40.5 33 44.5 34 63.0 35 89.0 36 111.5 37 130.0 38 146.0 39 169.5 40 200.0 41 230.5 42 240.5 43 255.0 44 278.0 45 285.0 46 277.5 47 243.5 48 215.0 49 177.5 50 142.0 51 119.5 52 91.5 53 78.5 54 62.5 55 40.5 56 32.0 57 27.5 58 23.5 59 18.0 60 8.5 61 7.5 62 9.0 63 7.0 64 5.0 65 4.5 66 3.5 67 1.0 68 1.5 69 1.5 70 1.5 71 2.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.025 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.025 52-53 0.0375 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra Read 1601583 spots for SRR3207815.sra Written 1601583 spots for SRR3207815.sra Read 1601573 spots for SRR3207815.sra Written 1601573 spots for SRR3207815.sra SRR ids: ['SRR3207815.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9plcuiu9 SRR3207815.sra spots: 32031470 blocks: [[1, 1601573], [1601574, 3203146], [3203147, 4804719], [4804720, 6406292], [6406293, 8007865], [8007866, 9609438], [9609439, 11211011], [11211012, 12812584], [12812585, 14414157], [14414158, 16015730], [16015731, 17617303], [17617304, 19218876], [19218877, 20820449], [20820450, 22422022], [22422023, 24023595], [24023596, 25625168], [25625169, 27226741], [27226742, 28828314], [28828315, 30429887], [30429888, 32031470]] SRR3207815 file size 8325224 SRR3207815 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207815 SRR3207815_1.fastq Input file: SRR3207815_1.fastq trimmed: SRR3207815-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 01:01:58 2025 >> started Tue Feb 11 01:02:18 2025 >> done (20.049s) 32031470 reads processed; of these: 5819 ( 0.02%) short reads filtered out after trimming by size control 42508 ( 0.13%) empty reads filtered out after trimming by size control 31983143 (99.85%) reads available; of these: 3146765 ( 9.84%) trimmed reads available after processing 28836378 (90.16%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1000 0.00% 19 1302 0.00% 20 1512 0.00% 21 2026 0.01% 22 2820 0.01% 23 3650 0.01% 24 4771 0.01% 25 6421 0.02% 26 6154 0.02% 27 6040 0.02% 28 6318 0.02% 29 6446 0.02% 30 6273 0.02% 31 6377 0.02% 32 6472 0.02% 33 6547 0.02% 34 7004 0.02% 35 7590 0.02% 36 8174 0.03% 37 8551 0.03% 38 8908 0.03% 39 9647 0.03% 40 10190 0.03% 41 10398 0.03% 42 11355 0.04% 43 11836 0.04% 44 12705 0.04% 45 13303 0.04% 46 13632 0.04% 47 14606 0.05% 48 15427 0.05% 49 16342 0.05% 50 17749 0.06% 51 17880 0.06% 52 18550 0.06% 53 19936 0.06% 54 21613 0.07% 55 22109 0.07% 56 23445 0.07% 57 23902 0.07% 58 25148 0.08% 59 24939 0.08% 60 25738 0.08% 61 25539 0.08% 62 25933 0.08% 63 25762 0.08% 64 26323 0.08% 65 26916 0.08% 66 26693 0.08% 67 28266 0.09% 68 28828 0.09% 69 29130 0.09% 70 29887 0.09% 71 30328 0.09% 72 31809 0.10% 73 32327 0.10% 74 32799 0.10% 75 32615 0.10% 76 24214 0.08% 77 27656 0.09% 78 31537 0.10% 79 35034 0.11% 80 37864 0.12% 81 41045 0.13% 82 44274 0.14% 83 47538 0.15% 84 49273 0.15% 85 53505 0.17% 86 57537 0.18% 87 62034 0.19% 88 65763 0.21% 89 70632 0.22% 90 80084 0.25% 91 90611 0.28% 92 101293 0.32% 93 115893 0.36% 94 133932 0.42% 95 157178 0.49% 96 184394 0.58% 97 217116 0.68% 98 244837 0.77% 99 245560 0.77% 100 28836378 90.16% 31983143 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=10.35 fanout-score-rank=19 prefix-density=0.07 prefix-fanout=10.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=295.38 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=28.4 sequence=TTCTTCTTCTTC Started job on | Feb 11 01:02:36 Started mapping on | Feb 11 01:02:36 Finished on | Feb 11 01:03:17 Mapping speed, Million of reads per hour | 2808.28 Number of input reads | 31983143 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 29813445 Uniquely mapped reads % | 93.22% Average mapped length | 97.96 Number of splices: Total | 8213673 Number of splices: Annotated (sjdb) | 8041988 Number of splices: GT/AG | 8085934 Number of splices: GC/AG | 103430 Number of splices: AT/AC | 8872 Number of splices: Non-canonical | 15437 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 682959 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 166949 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.12% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1486739 1486739 1486739 N_multimapping 682959 682959 682959 N_noFeature 1504805 15502921 15569587 N_ambiguous 355634 54725 55683 UnstrandedReadsAssigned:27953006 PositiveStrandReadsAssigned:14255799 NegativeStrandReadsAssigned:14188175 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207815 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207815-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,983,143 reads, 28,703,821 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52401 SRR3207815.ke.tsv 34699 SRR3207815.se.tsv 87100 total ==> SRR3207815.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1447 38.8939 Potri.005G024800.1.v4.1 1035 936 259.016 14.2737 Potri.004G059700.1.v4.1 961 862 29 1.73531 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 437.941 7.9428 Potri.016G087400.1.v4.1 270 171 1069 322.455 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 123.695 3.81141 Potri.012G127500.1.v4.1 977 878 2724 160.029 ==> SRR3207815.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2843 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 545 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 39 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207815 completed mapping pipeline successfully