Starting /dee2/code/volunteer_pipeline.sh SRR3207816 current disk space = 3057203675136 free memory = 1337580768 SRR3207816 SRAfilesize ad85591313ccbbc3ccfc7bacb2fead27 SRR3207816.sra SRR3207816.sra file validated SRR3207816 is single end SRR3207816 is conventional basespace SRR3207816 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207816_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.962 34.0 31.0 34.0 31.0 34.0 2 33.1565 34.0 33.0 34.0 31.0 34.0 3 33.20775 34.0 34.0 34.0 31.0 34.0 4 36.54375 37.0 37.0 37.0 35.0 37.0 5 36.52125 37.0 37.0 37.0 35.0 37.0 6 36.49175 37.0 37.0 37.0 35.0 37.0 7 36.49375 37.0 37.0 37.0 35.0 37.0 8 36.46475 37.0 37.0 37.0 35.0 37.0 9 38.2005 39.0 39.0 39.0 37.0 39.0 10-11 38.088499999999996 39.0 38.5 39.0 36.0 39.0 12-13 38.165 39.0 39.0 39.0 37.0 39.0 14-15 39.74575 41.0 40.0 41.0 37.0 41.0 16-17 39.74625 41.0 40.0 41.0 37.5 41.0 18-19 39.701625 41.0 40.0 41.0 37.0 41.0 20-21 39.697375 41.0 40.0 41.0 37.0 41.0 22-23 39.636 41.0 40.0 41.0 37.0 41.0 24-25 39.543375 41.0 40.0 41.0 37.0 41.0 26-27 39.420249999999996 41.0 39.5 41.0 36.5 41.0 28-29 39.293125 41.0 39.0 41.0 36.0 41.0 30-31 38.94925 40.0 39.0 41.0 35.5 41.0 32-33 39.140375 41.0 39.0 41.0 36.0 41.0 34-35 39.2465 41.0 39.0 41.0 36.0 41.0 36-37 39.30575 41.0 39.0 41.0 36.0 41.0 38-39 39.049875 40.5 38.5 41.0 35.5 41.0 40-41 39.0415 40.0 39.0 41.0 35.0 41.0 42-43 38.892624999999995 40.0 38.5 41.0 35.0 41.0 44-45 38.965625 40.0 39.0 41.0 35.0 41.0 46-47 38.821625 40.0 38.5 41.0 35.0 41.0 48-49 38.757875 40.0 38.5 41.0 35.0 41.0 50-51 38.711375000000004 40.0 39.0 41.0 35.0 41.0 52-53 38.53425 40.0 38.0 41.0 34.5 41.0 54-55 38.11450000000001 40.0 38.0 41.0 33.5 41.0 56-57 38.200874999999996 40.0 38.0 41.0 34.0 41.0 58-59 38.10225 40.0 37.5 41.0 34.0 41.0 60-61 37.5325 39.5 36.5 41.0 32.5 41.0 62-63 37.357375000000005 39.0 36.0 41.0 33.0 41.0 64-65 37.187375 39.0 36.0 40.5 32.5 41.0 66-67 36.682249999999996 38.5 35.0 40.0 31.5 41.0 68-69 36.29175 37.5 35.0 40.0 31.0 41.0 70-71 35.755750000000006 37.0 35.0 39.0 31.0 41.0 72-73 35.46575 36.5 35.0 39.0 31.0 40.0 74-75 35.011625 36.0 35.0 38.5 30.5 40.0 76-77 33.976875 35.0 33.5 37.0 29.5 39.0 78-79 34.17775 35.0 34.0 37.0 30.5 39.0 80-81 33.715 35.0 34.0 36.5 29.5 38.0 82-83 33.246875 35.0 34.0 36.0 29.0 37.0 84-85 33.09775 35.0 34.0 36.0 29.0 37.0 86-87 32.9935 35.0 34.0 35.0 29.0 36.0 88-89 32.657250000000005 35.0 33.5 35.0 28.0 36.0 90-91 32.486000000000004 35.0 34.0 35.0 28.5 36.0 92-93 32.371 35.0 33.0 35.0 29.0 36.0 94-95 32.214 35.0 33.0 35.0 28.0 35.0 96-97 31.493125 34.0 32.0 35.0 25.0 35.0 98-99 31.499000000000002 34.5 32.5 35.0 25.0 35.0 100 31.4245 34.0 33.0 35.0 26.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 1.0 12 4.0 13 5.0 14 4.0 15 5.0 16 5.0 17 7.0 18 3.0 19 10.0 20 6.0 21 7.0 22 8.0 23 9.0 24 12.0 25 17.0 26 20.0 27 25.0 28 34.0 29 34.0 30 43.0 31 62.0 32 75.0 33 75.0 34 120.0 35 195.0 36 393.0 37 881.0 38 1656.0 39 282.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.224999999999998 16.35 14.975 43.45 2 19.275000000000002 24.375 36.525 19.825 3 21.005251312828207 27.53188297074269 27.38184546136534 24.081020255063766 4 24.25 33.25 20.724999999999998 21.775 5 23.375 35.525 22.675 18.425 6 18.3 37.75 24.5 19.45 7 16.950000000000003 19.0 43.25 20.8 8 19.375 23.775 29.125 27.725 9 19.375 24.05 33.0 23.575 10-11 22.6375 32.6125 23.5375 21.212500000000002 12-13 19.925 27.200000000000003 29.725 23.150000000000002 14-15 21.265158144768094 27.390923865483185 28.766095761970245 22.577822227778473 16-17 21.475 29.025000000000002 27.3625 22.1375 18-19 21.1875 27.9125 27.950000000000003 22.95 20-21 22.1875 28.625 27.6875 21.5 22-23 21.087500000000002 29.049999999999997 27.6125 22.25 24-25 20.7 28.825 27.5875 22.8875 26-27 21.512500000000003 28.1125 27.575 22.8 28-29 21.3125 28.3625 28.249999999999996 22.075 30-31 21.587500000000002 28.6875 27.8125 21.912499999999998 32-33 22.0125 27.6875 27.9375 22.3625 34-35 21.125 28.4375 28.6375 21.8 36-37 21.525 29.4375 27.4125 21.625 38-39 21.325 27.875 27.8875 22.912499999999998 40-41 21.8125 29.175 27.437499999999996 21.575 42-43 22.225 28.4375 27.250000000000004 22.0875 44-45 22.3875 28.6875 27.287499999999998 21.637500000000003 46-47 21.675 28.3375 27.8875 22.1 48-49 21.475 28.375 28.3625 21.7875 50-51 21.958234337876704 28.61072902338377 26.985119419782418 22.44591721895711 52-53 22.311155577788895 28.5767883941971 26.775887943971988 22.336168084042022 54-55 21.3875 28.537499999999998 28.4125 21.6625 56-57 21.912499999999998 28.6875 28.175 21.224999999999998 58-59 21.7875 28.799999999999997 27.425 21.987499999999997 60-61 22.275 28.287499999999998 27.425 22.0125 62-63 21.099999999999998 28.3625 28.575 21.9625 64-65 21.8875 28.95 27.1125 22.05 66-67 21.8875 28.599999999999998 27.625 21.8875 68-69 21.775 28.825 27.737499999999997 21.6625 70-71 21.4875 28.9 27.575 22.037499999999998 72-73 21.9375 28.3625 28.299999999999997 21.4 74-75 21.4125 28.249999999999996 28.0625 22.275 76-77 21.712500000000002 28.3625 27.762500000000003 22.162499999999998 78-79 21.3 27.5625 28.9375 22.2 80-81 22.037499999999998 29.212500000000002 26.8125 21.9375 82-83 21.4375 28.9875 28.249999999999996 21.325 84-85 21.6875 28.675 28.175 21.462500000000002 86-87 21.727715964495562 28.19102387798475 28.028503562945367 22.052756594574323 88-89 21.955488872218055 28.419604901225306 27.494373593398347 22.13053263315829 90-91 21.605401350337583 28.619654913728432 28.26956739184796 21.50537634408602 92-93 21.575 27.474999999999998 29.012500000000003 21.9375 94-95 21.2875 28.6125 27.9125 22.1875 96-97 22.2 26.9625 27.6 23.2375 98-99 21.3875 28.175 28.175 22.2625 100 22.0 28.625 28.549999999999997 20.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.5 24 3.0 25 4.5 26 5.5 27 6.0 28 11.0 29 17.0 30 22.5 31 25.0 32 32.5 33 48.0 34 63.0 35 79.0 36 98.5 37 125.0 38 145.0 39 173.0 40 211.5 41 230.5 42 243.5 43 243.0 44 256.5 45 273.0 46 259.5 47 244.0 48 217.0 49 191.0 50 167.0 51 134.5 52 107.5 53 89.0 54 58.0 55 35.0 56 34.5 57 36.0 58 27.5 59 18.5 60 15.5 61 11.0 62 7.5 63 4.0 64 3.5 65 4.5 66 3.5 67 2.0 68 2.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0125 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0375 52-53 0.05 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.025 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79924717691343 99.425 2 0.17565872020075282 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02509410288582183 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 3 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998239 spots for SRR3207816.sra Written 998239 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra Read 998224 spots for SRR3207816.sra Written 998224 spots for SRR3207816.sra SRR ids: ['SRR3207816.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6j3123j_ SRR3207816.sra spots: 19964495 blocks: [[1, 998224], [998225, 1996448], [1996449, 2994672], [2994673, 3992896], [3992897, 4991120], [4991121, 5989344], [5989345, 6987568], [6987569, 7985792], [7985793, 8984016], [8984017, 9982240], [9982241, 10980464], [10980465, 11978688], [11978689, 12976912], [12976913, 13975136], [13975137, 14973360], [14973361, 15971584], [15971585, 16969808], [16969809, 17968032], [17968033, 18966256], [18966257, 19964495]] SRR3207816 file size 5184827 SRR3207816 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207816 SRR3207816_1.fastq Input file: SRR3207816_1.fastq trimmed: SRR3207816-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 00:36:02 2025 >> started Tue Feb 11 00:36:12 2025 >> done (10.534s) 19964495 reads processed; of these: 2827 ( 0.01%) short reads filtered out after trimming by size control 42844 ( 0.21%) empty reads filtered out after trimming by size control 19918824 (99.77%) reads available; of these: 2048837 (10.29%) trimmed reads available after processing 17869987 (89.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 555 0.00% 19 712 0.00% 20 853 0.00% 21 1124 0.01% 22 1670 0.01% 23 2141 0.01% 24 2815 0.01% 25 3867 0.02% 26 3797 0.02% 27 3548 0.02% 28 3680 0.02% 29 3825 0.02% 30 3811 0.02% 31 3738 0.02% 32 3895 0.02% 33 4062 0.02% 34 4289 0.02% 35 4766 0.02% 36 5110 0.03% 37 5258 0.03% 38 5552 0.03% 39 5897 0.03% 40 6327 0.03% 41 6445 0.03% 42 7174 0.04% 43 7305 0.04% 44 7729 0.04% 45 8121 0.04% 46 8421 0.04% 47 9060 0.05% 48 9827 0.05% 49 10537 0.05% 50 11119 0.06% 51 11344 0.06% 52 12004 0.06% 53 12627 0.06% 54 13777 0.07% 55 14470 0.07% 56 14943 0.08% 57 15389 0.08% 58 16243 0.08% 59 15998 0.08% 60 16545 0.08% 61 16233 0.08% 62 16401 0.08% 63 16549 0.08% 64 16828 0.08% 65 17291 0.09% 66 17373 0.09% 67 18477 0.09% 68 18785 0.09% 69 19122 0.10% 70 19569 0.10% 71 20108 0.10% 72 20586 0.10% 73 21014 0.11% 74 21252 0.11% 75 21435 0.11% 76 15554 0.08% 77 17836 0.09% 78 20766 0.10% 79 22766 0.11% 80 25048 0.13% 81 26668 0.13% 82 28664 0.14% 83 31174 0.16% 84 32418 0.16% 85 34995 0.18% 86 37791 0.19% 87 40371 0.20% 88 43210 0.22% 89 46537 0.23% 90 52583 0.26% 91 59552 0.30% 92 66493 0.33% 93 76118 0.38% 94 88417 0.44% 95 104065 0.52% 96 121427 0.61% 97 142767 0.72% 98 160969 0.81% 99 161255 0.81% 100 17869987 89.71% 19918824 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=1.88 fanout-score-rank=38 prefix-density=0.03 prefix-fanout=1.9 sequence=TCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=10 fanout-score=300.34 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=29.8 sequence=TTCTTCTTCTTT Started job on | Feb 11 00:36:29 Started mapping on | Feb 11 00:36:29 Finished on | Feb 11 00:36:55 Mapping speed, Million of reads per hour | 2757.99 Number of input reads | 19918824 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 18677000 Uniquely mapped reads % | 93.77% Average mapped length | 97.93 Number of splices: Total | 5159646 Number of splices: Annotated (sjdb) | 5056806 Number of splices: GT/AG | 5079885 Number of splices: GC/AG | 64766 Number of splices: AT/AC | 5509 Number of splices: Non-canonical | 9486 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437890 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 137712 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.34% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 803934 803934 803934 N_multimapping 437890 437890 437890 N_noFeature 892273 9675609 9744295 N_ambiguous 217981 34163 34757 UnstrandedReadsAssigned:17566746 PositiveStrandReadsAssigned:8967228 NegativeStrandReadsAssigned:8897948 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207816 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207816-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,918,824 reads, 18,065,134 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR3207816.ke.tsv 34699 SRR3207816.se.tsv 87100 total ==> SRR3207816.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 904 37.9554 Potri.005G024800.1.v4.1 1035 936 155 13.3425 Potri.004G059700.1.v4.1 961 862 20 1.8694 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 303.362 8.59434 Potri.016G087400.1.v4.1 270 171 716 337.363 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 94.7312 4.55951 Potri.012G127500.1.v4.1 977 878 2580 236.759 ==> SRR3207816.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1818 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 366 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207816 completed mapping pipeline successfully