Starting /dee2/code/volunteer_pipeline.sh SRR3207817 current disk space = 3056987987968 free memory = 1576441556 SRR3207817 SRAfilesize a1cb9b1cd139a632015100a7c29f8e47 SRR3207817.sra SRR3207817.sra file validated SRR3207817 is single end SRR3207817 is conventional basespace SRR3207817 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207817_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03875 34.0 33.0 34.0 31.0 34.0 2 33.208 34.0 34.0 34.0 31.0 34.0 3 33.272 34.0 34.0 34.0 31.0 34.0 4 36.6015 37.0 37.0 37.0 35.0 37.0 5 36.51925 37.0 37.0 37.0 35.0 37.0 6 36.505 37.0 37.0 37.0 35.0 37.0 7 36.5055 37.0 37.0 37.0 35.0 37.0 8 36.501 37.0 37.0 37.0 35.0 37.0 9 38.24775 39.0 39.0 39.0 37.0 39.0 10-11 38.161875 39.0 39.0 39.0 36.0 39.0 12-13 38.215125 39.0 39.0 39.0 37.0 39.0 14-15 39.823875 41.0 40.0 41.0 38.0 41.0 16-17 39.82525 41.0 40.0 41.0 38.0 41.0 18-19 39.743 41.0 40.0 41.0 37.5 41.0 20-21 39.7675 41.0 40.0 41.0 37.5 41.0 22-23 39.696875 41.0 40.0 41.0 37.5 41.0 24-25 39.586375000000004 41.0 40.0 41.0 37.0 41.0 26-27 39.470875 41.0 40.0 41.0 37.0 41.0 28-29 39.268249999999995 41.0 39.0 41.0 36.0 41.0 30-31 38.8455 41.0 39.0 41.0 35.0 41.0 32-33 39.153625000000005 41.0 39.0 41.0 36.0 41.0 34-35 39.2665 41.0 39.0 41.0 36.0 41.0 36-37 39.350875 41.0 40.0 41.0 36.5 41.0 38-39 39.048249999999996 40.5 39.5 41.0 35.5 41.0 40-41 39.017125 41.0 39.0 41.0 35.0 41.0 42-43 38.822 40.0 39.0 41.0 35.0 41.0 44-45 38.902375 40.0 39.0 41.0 35.0 41.0 46-47 38.692 40.5 38.5 41.0 34.5 41.0 48-49 38.67675 40.0 39.0 41.0 35.0 41.0 50-51 38.62325 40.0 38.5 41.0 35.0 41.0 52-53 38.36 40.0 38.0 41.0 34.0 41.0 54-55 37.848875 40.0 38.0 41.0 33.0 41.0 56-57 37.966 40.0 38.0 41.0 33.5 41.0 58-59 37.81325 40.0 37.0 41.0 33.5 41.0 60-61 37.426500000000004 39.5 36.5 41.0 32.5 41.0 62-63 37.279875000000004 39.0 36.0 41.0 33.0 41.0 64-65 37.028375 39.0 36.0 40.5 33.0 41.0 66-67 36.471000000000004 38.5 35.0 40.0 31.5 41.0 68-69 36.186375 37.5 35.0 40.0 31.0 41.0 70-71 35.710875 37.0 35.0 39.0 31.0 41.0 72-73 35.418 37.0 35.0 39.0 31.0 41.0 74-75 34.958875 36.0 35.0 38.5 31.0 40.0 76-77 33.91175 35.0 33.5 37.0 29.5 39.0 78-79 34.046375 35.0 34.0 37.0 30.0 39.0 80-81 33.63175 35.0 34.0 36.5 29.0 38.5 82-83 33.211 35.0 34.0 36.0 29.0 37.0 84-85 33.0635 35.0 34.0 36.0 29.0 37.0 86-87 33.01975 35.0 34.0 35.0 29.0 36.5 88-89 32.4845 35.0 33.5 35.0 28.0 36.0 90-91 32.386875 35.0 33.5 35.0 28.5 36.0 92-93 32.3725 35.0 33.5 35.0 29.0 36.0 94-95 32.229 35.0 34.0 35.0 29.0 35.0 96-97 31.548875000000002 35.0 33.0 35.0 25.0 35.0 98-99 31.63575 35.0 33.0 35.0 26.5 35.0 100 31.4405 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 3.0 10 4.0 11 2.0 12 3.0 13 3.0 14 8.0 15 7.0 16 10.0 17 7.0 18 8.0 19 7.0 20 11.0 21 8.0 22 13.0 23 9.0 24 12.0 25 14.0 26 20.0 27 22.0 28 20.0 29 41.0 30 48.0 31 47.0 32 65.0 33 75.0 34 106.0 35 189.0 36 350.0 37 885.0 38 1638.0 39 362.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.799999999999997 15.575 16.975 43.65 2 18.55 24.975 36.675000000000004 19.8 3 22.7 28.325 26.450000000000003 22.525000000000002 4 24.175 31.974999999999998 20.925 22.925 5 23.3 36.575 23.275000000000002 16.85 6 17.75 37.0 25.2 20.05 7 16.925 18.099999999999998 44.5 20.474999999999998 8 19.325 23.175 28.9 28.599999999999998 9 20.95 21.95 32.375 24.725 10-11 22.0125 32.7875 23.9375 21.2625 12-13 20.125 27.0125 29.9875 22.875 14-15 21.4875 28.287499999999998 28.675 21.55 16-17 22.15 27.525 28.625 21.7 18-19 22.225 28.625 27.55 21.6 20-21 20.724999999999998 28.675 28.299999999999997 22.3 22-23 21.95 28.999999999999996 27.35 21.7 24-25 21.837500000000002 27.800000000000004 28.762500000000003 21.6 26-27 21.0625 28.962500000000002 28.5875 21.3875 28-29 22.2125 27.800000000000004 27.1 22.8875 30-31 21.2875 27.85 28.6125 22.25 32-33 20.9 28.65 28.462500000000002 21.987499999999997 34-35 21.762500000000003 28.9875 27.9125 21.337500000000002 36-37 21.0625 28.499999999999996 28.175 22.2625 38-39 21.3875 28.125 28.4 22.0875 40-41 21.95 29.1375 27.775 21.1375 42-43 21.45 29.5 27.462500000000002 21.587500000000002 44-45 21.3125 29.012500000000003 27.5125 22.162499999999998 46-47 22.025 28.962500000000002 27.462500000000002 21.55 48-49 22.0625 27.650000000000002 28.249999999999996 22.037499999999998 50-51 22.263914946841776 28.392745465916196 27.529706066291432 21.813633520950596 52-53 22.57257257257257 28.653653653653656 27.615115115115113 21.15865865865866 54-55 22.2 28.349999999999998 27.6875 21.762500000000003 56-57 21.425 28.749999999999996 27.625 22.2 58-59 22.2 28.012500000000003 28.9125 20.875 60-61 22.0625 28.037499999999998 27.975 21.925 62-63 21.4125 28.5625 28.9125 21.1125 64-65 22.575 28.1125 28.3125 21.0 66-67 22.225 28.549999999999997 28.1125 21.1125 68-69 22.0125 28.4125 28.262500000000003 21.3125 70-71 21.6625 28.3125 28.025 22.0 72-73 22.3 28.8875 27.775 21.0375 74-75 21.912499999999998 28.3375 28.037499999999998 21.712500000000002 76-77 22.625 27.975 27.875 21.525 78-79 21.4375 28.3375 28.462500000000002 21.762500000000003 80-81 21.7 29.599999999999998 27.700000000000003 21.0 82-83 21.05 27.775 29.075 22.1 84-85 22.5125 27.9125 28.1125 21.462500000000002 86-87 21.6625 27.875 28.9875 21.475 88-89 21.780445111277817 27.84446111527882 27.969492373093274 22.405601400350086 90-91 21.710855427713856 28.12656328164082 28.40170085042521 21.76088044022011 92-93 21.8 28.287499999999998 28.625 21.2875 94-95 22.05 28.275 28.1375 21.5375 96-97 21.4375 27.737499999999997 29.025000000000002 21.8 98-99 22.475 28.3375 28.5875 20.599999999999998 100 21.85 27.125 28.825 22.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 1.5 18 1.0 19 0.0 20 1.0 21 2.0 22 3.0 23 3.5 24 3.5 25 6.5 26 10.0 27 13.5 28 14.0 29 18.5 30 23.0 31 28.0 32 43.0 33 61.5 34 67.5 35 72.0 36 92.5 37 122.0 38 152.0 39 168.5 40 185.0 41 212.5 42 244.5 43 270.0 44 262.0 45 259.0 46 258.0 47 231.0 48 209.5 49 189.5 50 172.0 51 134.0 52 100.5 53 85.0 54 65.5 55 48.0 56 29.5 57 27.5 58 26.0 59 15.0 60 10.5 61 11.0 62 9.0 63 5.0 64 6.0 65 6.0 66 3.5 67 3.0 68 2.5 69 3.0 70 2.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0625 52-53 0.1 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.025 90-91 0.05 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8747808665164 99.7 2 0.10017530678687703 0.2 3 0.0 0.0 4 0.025043826696719257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra Read 1166898 spots for SRR3207817.sra Written 1166898 spots for SRR3207817.sra Read 1166886 spots for SRR3207817.sra Written 1166886 spots for SRR3207817.sra SRR ids: ['SRR3207817.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__rz9oxml SRR3207817.sra spots: 23337732 blocks: [[1, 1166886], [1166887, 2333772], [2333773, 3500658], [3500659, 4667544], [4667545, 5834430], [5834431, 7001316], [7001317, 8168202], [8168203, 9335088], [9335089, 10501974], [10501975, 11668860], [11668861, 12835746], [12835747, 14002632], [14002633, 15169518], [15169519, 16336404], [16336405, 17503290], [17503291, 18670176], [18670177, 19837062], [19837063, 21003948], [21003949, 22170834], [22170835, 23337732]] SRR3207817 file size 6062718 SRR3207817 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207817 SRR3207817_1.fastq Input file: SRR3207817_1.fastq trimmed: SRR3207817-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 02:40:32 2025 >> started Tue Feb 11 02:47:34 2025 >> done (422.015s) 23337732 reads processed; of these: 4670 ( 0.02%) short reads filtered out after trimming by size control 37702 ( 0.16%) empty reads filtered out after trimming by size control 23295360 (99.82%) reads available; of these: 2204711 ( 9.46%) trimmed reads available after processing 21090649 (90.54%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 873 0.00% 19 1046 0.00% 20 1206 0.01% 21 1614 0.01% 22 2216 0.01% 23 2837 0.01% 24 3696 0.02% 25 4895 0.02% 26 4899 0.02% 27 4547 0.02% 28 4773 0.02% 29 4775 0.02% 30 4772 0.02% 31 4809 0.02% 32 4870 0.02% 33 5198 0.02% 34 5545 0.02% 35 5878 0.03% 36 6306 0.03% 37 6408 0.03% 38 6855 0.03% 39 7054 0.03% 40 7516 0.03% 41 7803 0.03% 42 8529 0.04% 43 8675 0.04% 44 9430 0.04% 45 9587 0.04% 46 9944 0.04% 47 10802 0.05% 48 11288 0.05% 49 12029 0.05% 50 12698 0.05% 51 12828 0.06% 52 13533 0.06% 53 14251 0.06% 54 14957 0.06% 55 15919 0.07% 56 16708 0.07% 57 17445 0.07% 58 17844 0.08% 59 17800 0.08% 60 18168 0.08% 61 17911 0.08% 62 18232 0.08% 63 18145 0.08% 64 18763 0.08% 65 19167 0.08% 66 18958 0.08% 67 20071 0.09% 68 20512 0.09% 69 20341 0.09% 70 20883 0.09% 71 21672 0.09% 72 22066 0.09% 73 22431 0.10% 74 23288 0.10% 75 22757 0.10% 76 16984 0.07% 77 19121 0.08% 78 21886 0.09% 79 24224 0.10% 80 26647 0.11% 81 28388 0.12% 82 30582 0.13% 83 32572 0.14% 84 34021 0.15% 85 36804 0.16% 86 40031 0.17% 87 42779 0.18% 88 45922 0.20% 89 48597 0.21% 90 55526 0.24% 91 62646 0.27% 92 69582 0.30% 93 79627 0.34% 94 92850 0.40% 95 109386 0.47% 96 127486 0.55% 97 150883 0.65% 98 168964 0.73% 99 171180 0.73% 100 21090649 90.54% 23295360 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=14.93 fanout-score-rank=17 prefix-density=0.10 prefix-fanout=14.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=311.96 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=28.8 sequence=TTCTTCTTCTTC Started job on | Feb 11 03:10:34 Started mapping on | Feb 11 03:11:25 Finished on | Feb 11 04:56:46 Mapping speed, Million of reads per hour | 13.27 Number of input reads | 23295360 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 21164507 Uniquely mapped reads % | 90.85% Average mapped length | 97.97 Number of splices: Total | 5703980 Number of splices: Annotated (sjdb) | 5586977 Number of splices: GT/AG | 5614569 Number of splices: GC/AG | 71569 Number of splices: AT/AC | 6152 Number of splices: Non-canonical | 11690 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 1.92 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 519600 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 255512 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.81% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1611253 1611253 1611253 N_multimapping 519600 519600 519600 N_noFeature 1047416 11001056 11037092 N_ambiguous 249880 37760 38676 UnstrandedReadsAssigned:19867211 PositiveStrandReadsAssigned:10125691 NegativeStrandReadsAssigned:10088739 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207817 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207817-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,295,360 reads, 20,549,818 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,284 rounds 52401 SRR3207817.ke.tsv 34699 SRR3207817.se.tsv 87100 total ==> SRR3207817.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 893 32.8072 Potri.005G024800.1.v4.1 1035 936 151 11.3735 Potri.004G059700.1.v4.1 961 862 33 2.69898 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 371.714 9.21453 Potri.016G087400.1.v4.1 270 171 822 338.898 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 122.72 5.16837 Potri.012G127500.1.v4.1 977 878 3248 260.804 ==> SRR3207817.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1845 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 358 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 51 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207817 completed mapping pipeline successfully