Starting /dee2/code/volunteer_pipeline.sh SRR3207818 current disk space = 3056936935424 free memory = 1580065212 SRR3207818 SRAfilesize 6b33a8fe18d678e3656eebe6df19bb37 SRR3207818.sra SRR3207818.sra file validated SRR3207818 is single end SRR3207818 is conventional basespace SRR3207818 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207818_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0535 34.0 33.0 34.0 31.0 34.0 2 33.279 34.0 33.0 34.0 31.0 34.0 3 33.40875 34.0 34.0 34.0 31.0 34.0 4 36.5475 37.0 37.0 37.0 35.0 37.0 5 36.4685 37.0 37.0 37.0 35.0 37.0 6 36.546 37.0 37.0 37.0 35.0 37.0 7 36.57675 37.0 37.0 37.0 35.0 37.0 8 36.6055 37.0 37.0 37.0 35.0 37.0 9 38.46475 39.0 39.0 39.0 37.0 39.0 10-11 38.356125000000006 39.0 39.0 39.0 37.0 39.0 12-13 38.380875 39.0 39.0 39.0 37.0 39.0 14-15 39.893125 41.0 40.0 41.0 38.0 41.0 16-17 39.951375 41.0 40.0 41.0 38.0 41.0 18-19 40.004 41.0 40.0 41.0 38.0 41.0 20-21 39.984750000000005 41.0 40.0 41.0 38.0 41.0 22-23 39.829499999999996 41.0 40.0 41.0 38.0 41.0 24-25 39.872875 41.0 40.0 41.0 38.0 41.0 26-27 39.720625 41.0 40.0 41.0 38.0 41.0 28-29 39.654125 41.0 40.0 41.0 37.5 41.0 30-31 39.561375 41.0 40.0 41.0 37.0 41.0 32-33 39.604124999999996 41.0 40.0 41.0 37.0 41.0 34-35 39.6235 41.0 40.0 41.0 37.0 41.0 36-37 39.142125 41.0 39.0 41.0 36.0 41.0 38-39 39.41775 41.0 40.0 41.0 37.0 41.0 40-41 38.913624999999996 40.5 39.0 41.0 35.0 41.0 42-43 39.184875 41.0 39.0 41.0 36.5 41.0 44-45 39.346500000000006 41.0 39.5 41.0 37.0 41.0 46-47 39.396625 41.0 40.0 41.0 37.0 41.0 48-49 39.457 41.0 40.0 41.0 37.0 41.0 50-51 39.24275 41.0 39.5 41.0 36.0 41.0 52-53 39.010875 40.5 39.0 41.0 35.5 41.0 54-55 38.907125 40.0 39.0 41.0 35.0 41.0 56-57 38.817625 40.0 38.5 41.0 35.0 41.0 58-59 38.571625 40.0 38.0 41.0 35.0 41.0 60-61 38.337 40.0 37.5 41.0 35.0 41.0 62-63 37.729125 39.5 36.5 41.0 33.5 41.0 64-65 37.236 39.0 36.0 41.0 33.0 41.0 66-67 37.273875000000004 39.0 36.0 40.0 34.0 41.0 68-69 36.661625 37.5 35.0 40.0 32.5 41.0 70-71 36.3815 37.0 35.0 39.0 33.0 41.0 72-73 35.894625000000005 37.0 35.0 39.0 32.0 40.5 74-75 35.343999999999994 36.0 35.0 38.5 31.5 39.5 76-77 34.34525 35.0 33.5 37.0 30.5 39.0 78-79 34.613875 35.0 34.0 37.0 31.5 39.0 80-81 34.393125 35.0 34.0 36.5 31.0 38.0 82-83 34.195 35.0 34.0 36.0 31.5 37.0 84-85 33.91975 35.0 34.0 36.0 31.0 37.0 86-87 33.75025 35.0 34.0 35.0 31.0 36.5 88-89 33.377625 35.0 34.0 35.0 30.5 36.0 90-91 33.302375 35.0 34.0 35.0 31.0 36.0 92-93 33.219375 35.0 34.0 35.0 31.0 36.0 94-95 33.095 35.0 34.0 35.0 31.0 35.0 96-97 32.752875 35.0 34.0 35.0 29.5 35.0 98-99 32.6445 35.0 34.0 35.0 30.0 35.0 100 32.55425 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 1.0 8 1.0 9 0.0 10 1.0 11 2.0 12 2.0 13 0.0 14 2.0 15 4.0 16 4.0 17 0.0 18 5.0 19 5.0 20 4.0 21 3.0 22 6.0 23 8.0 24 8.0 25 11.0 26 10.0 27 9.0 28 18.0 29 29.0 30 35.0 31 32.0 32 55.0 33 85.0 34 92.0 35 159.0 36 315.0 37 928.0 38 1827.0 39 337.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.5 14.899999999999999 13.975000000000001 44.625 2 18.05 24.25 38.550000000000004 19.15 3 21.725 27.375 26.200000000000003 24.7 4 25.275 33.225 20.075000000000003 21.425 5 24.681170292573142 34.53363340835209 23.055763940985248 17.72943235808952 6 17.7 37.2 25.074999999999996 20.025000000000002 7 16.35 19.25 43.175000000000004 21.224999999999998 8 19.55 22.475 29.775000000000002 28.199999999999996 9 20.3 24.725 30.5 24.474999999999998 10-11 23.150000000000002 33.225 23.0125 20.6125 12-13 20.175 26.2625 29.825000000000003 23.7375 14-15 21.156735102653982 28.129694541812718 28.480220330495744 22.233350025037556 16-17 22.037499999999998 28.237499999999997 26.7625 22.9625 18-19 21.85 28.375 27.8375 21.9375 20-21 21.512500000000003 28.037499999999998 27.487499999999997 22.9625 22-23 21.425 29.012500000000003 27.437499999999996 22.125 24-25 21.224999999999998 28.5875 27.962500000000002 22.225 26-27 22.412499999999998 28.975 26.375 22.237499999999997 28-29 21.4125 28.8875 26.85 22.85 30-31 21.15 28.799999999999997 27.625 22.425 32-33 22.45 29.037499999999998 27.237499999999997 21.275 34-35 22.425 28.0875 27.750000000000004 21.7375 36-37 21.825 28.599999999999998 27.250000000000004 22.325 38-39 22.1 28.175 27.8375 21.8875 40-41 22.775000000000002 27.962500000000002 28.037499999999998 21.224999999999998 42-43 21.5 28.975 27.8125 21.712500000000002 44-45 22.1375 28.512500000000003 27.55 21.8 46-47 21.525 28.262500000000003 27.6375 22.575 48-49 21.125 28.65 27.6625 22.5625 50-51 21.096096096096094 28.103103103103106 28.678678678678676 22.12212212212212 52-53 21.955188384028038 28.81462010264113 27.913380898735763 21.31681061459507 54-55 21.087500000000002 28.487499999999997 28.000000000000004 22.425 56-57 22.3125 27.875 28.212500000000002 21.6 58-59 21.75 28.499999999999996 28.3625 21.3875 60-61 21.45 29.4125 27.375 21.762500000000003 62-63 22.05 28.449999999999996 27.725 21.775 64-65 21.525 28.775000000000002 27.762500000000003 21.9375 66-67 21.25 29.099999999999998 27.750000000000004 21.9 68-69 22.0125 27.150000000000002 28.975 21.8625 70-71 21.4375 28.575 28.1 21.8875 72-73 21.45 28.299999999999997 28.7375 21.512500000000003 74-75 22.0 28.025 27.9125 22.0625 76-77 21.3 29.175 27.8625 21.6625 78-79 22.125 28.212500000000002 28.075 21.587500000000002 80-81 21.95 28.1125 28.275 21.6625 82-83 21.65 28.487499999999997 28.4375 21.425 84-85 21.75 28.475 27.800000000000004 21.975 86-87 21.725 27.400000000000002 28.375 22.5 88-89 21.360680340170084 28.36418209104552 28.65182591295648 21.623311655827916 90-91 21.928946710032523 28.05854390793095 28.396297222917187 21.61621215911934 92-93 21.6929232308077 27.481870467616904 29.41985496374094 21.405351337834457 94-95 21.15 28.487499999999997 28.212500000000002 22.15 96-97 21.5625 29.7 27.237499999999997 21.5 98-99 22.2 27.500000000000004 28.8625 21.4375 100 23.3 26.55 28.199999999999996 21.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.5 25 3.0 26 4.0 27 7.0 28 10.5 29 13.0 30 22.0 31 34.0 32 38.5 33 48.0 34 67.5 35 72.0 36 79.5 37 107.0 38 138.0 39 169.5 40 185.5 41 213.5 42 250.0 43 278.5 44 283.5 45 266.0 46 261.0 47 260.5 48 231.0 49 186.5 50 165.5 51 141.0 52 108.5 53 82.5 54 67.5 55 52.5 56 37.5 57 30.5 58 20.5 59 10.5 60 7.0 61 5.0 62 5.0 63 7.5 64 6.0 65 3.5 66 4.5 67 3.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.15 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.1 52-53 0.13749999999999998 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.05 90-91 0.075 92-93 0.025 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189451 spots for SRR3207818.sra Written 3189451 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra Read 3189434 spots for SRR3207818.sra Written 3189434 spots for SRR3207818.sra SRR ids: ['SRR3207818.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pvh8lmh0 SRR3207818.sra spots: 63788697 blocks: [[1, 3189434], [3189435, 6378868], [6378869, 9568302], [9568303, 12757736], [12757737, 15947170], [15947171, 19136604], [19136605, 22326038], [22326039, 25515472], [25515473, 28704906], [28704907, 31894340], [31894341, 35083774], [35083775, 38273208], [38273209, 41462642], [41462643, 44652076], [44652077, 47841510], [47841511, 51030944], [51030945, 54220378], [54220379, 57409812], [57409813, 60599246], [60599247, 63788697]] SRR3207818 file size 16589627 SRR3207818 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207818 SRR3207818_1.fastq Input file: SRR3207818_1.fastq trimmed: SRR3207818-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 04:44:40 2025 >> started Tue Feb 11 04:52:41 2025 >> done (481.523s) 63788697 reads processed; of these: 13906 ( 0.02%) short reads filtered out after trimming by size control 58968 ( 0.09%) empty reads filtered out after trimming by size control 63715823 (99.89%) reads available; of these: 6297097 ( 9.88%) trimmed reads available after processing 57418726 (90.12%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2574 0.00% 19 3030 0.00% 20 3568 0.01% 21 4788 0.01% 22 6298 0.01% 23 8318 0.01% 24 10725 0.02% 25 14462 0.02% 26 13848 0.02% 27 13819 0.02% 28 14167 0.02% 29 13930 0.02% 30 13813 0.02% 31 13941 0.02% 32 14420 0.02% 33 14826 0.02% 34 16206 0.03% 35 16445 0.03% 36 17992 0.03% 37 18975 0.03% 38 19562 0.03% 39 20621 0.03% 40 21516 0.03% 41 22846 0.04% 42 24291 0.04% 43 25924 0.04% 44 27689 0.04% 45 28419 0.04% 46 28834 0.05% 47 30802 0.05% 48 31952 0.05% 49 33769 0.05% 50 36304 0.06% 51 37199 0.06% 52 39053 0.06% 53 41014 0.06% 54 44531 0.07% 55 45402 0.07% 56 48212 0.08% 57 49607 0.08% 58 50981 0.08% 59 49687 0.08% 60 50727 0.08% 61 51521 0.08% 62 51420 0.08% 63 52480 0.08% 64 52715 0.08% 65 52886 0.08% 66 53918 0.08% 67 55880 0.09% 68 57029 0.09% 69 57093 0.09% 70 59184 0.09% 71 60610 0.10% 72 61559 0.10% 73 63145 0.10% 74 64192 0.10% 75 63191 0.10% 76 45462 0.07% 77 52534 0.08% 78 59804 0.09% 79 65515 0.10% 80 71100 0.11% 81 77205 0.12% 82 84264 0.13% 83 91919 0.14% 84 95751 0.15% 85 104637 0.16% 86 114943 0.18% 87 121148 0.19% 88 128290 0.20% 89 138638 0.22% 90 154784 0.24% 91 171824 0.27% 92 194928 0.31% 93 219814 0.34% 94 260720 0.41% 95 309310 0.49% 96 367985 0.58% 97 440727 0.69% 98 519662 0.82% 99 504223 0.79% 100 57418726 90.12% 63715823 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=12.02 fanout-score-rank=13 prefix-density=0.09 prefix-fanout=12.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=16 fanout-score=259.51 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=27.3 sequence=TTCTTCTTCTTT Started job on | Feb 11 05:18:44 Started mapping on | Feb 11 05:18:56 Finished on | Feb 11 07:33:14 Mapping speed, Million of reads per hour | 28.47 Number of input reads | 63715823 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 60434618 Uniquely mapped reads % | 94.85% Average mapped length | 97.90 Number of splices: Total | 16474701 Number of splices: Annotated (sjdb) | 16154803 Number of splices: GT/AG | 16218418 Number of splices: GC/AG | 205147 Number of splices: AT/AC | 17793 Number of splices: Non-canonical | 33343 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 1.92 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1430747 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 480084 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1850458 1850458 1850458 N_multimapping 1430747 1430747 1430747 N_noFeature 2741153 31324532 31356932 N_ambiguous 702552 103360 105830 UnstrandedReadsAssigned:56990913 PositiveStrandReadsAssigned:29006726 NegativeStrandReadsAssigned:28971856 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207818 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207818-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 63,715,823 reads, 58,654,427 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52401 SRR3207818.ke.tsv 34699 SRR3207818.se.tsv 87100 total ==> SRR3207818.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2238 28.5888 Potri.005G024800.1.v4.1 1035 936 421 11.026 Potri.004G059700.1.v4.1 961 862 100 2.84383 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 903.465 7.78739 Potri.016G087400.1.v4.1 270 171 2388 342.333 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 251.547 3.68362 Potri.012G127500.1.v4.1 977 878 10365 289.391 ==> SRR3207818.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 6455 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 1277 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 115 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207818 completed mapping pipeline successfully