Starting /dee2/code/volunteer_pipeline.sh SRR3207819 current disk space = 3057368166400 free memory = 1272249548 SRR3207819 SRAfilesize 23b46159a57fcbbfdb246e60adac98db SRR3207819.sra SRR3207819.sra file validated SRR3207819 is single end SRR3207819 is conventional basespace SRR3207819 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207819_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.067 34.0 33.0 34.0 31.0 34.0 2 33.21125 34.0 33.0 34.0 31.0 34.0 3 33.31675 34.0 34.0 34.0 31.0 34.0 4 36.527 37.0 37.0 37.0 35.0 37.0 5 36.48725 37.0 37.0 37.0 35.0 37.0 6 36.52075 37.0 37.0 37.0 35.0 37.0 7 36.5085 37.0 37.0 37.0 35.0 37.0 8 36.5645 37.0 37.0 37.0 35.0 37.0 9 38.39775 39.0 39.0 39.0 37.0 39.0 10-11 38.356624999999994 39.0 39.0 39.0 37.0 39.0 12-13 38.322375 39.0 39.0 39.0 37.0 39.0 14-15 39.833125 41.0 40.0 41.0 38.0 41.0 16-17 39.748875 41.0 40.0 41.0 37.5 41.0 18-19 39.840125 41.0 40.0 41.0 38.0 41.0 20-21 39.817 41.0 40.0 41.0 38.0 41.0 22-23 39.76625 41.0 40.0 41.0 37.5 41.0 24-25 39.759625 41.0 40.0 41.0 38.0 41.0 26-27 39.65875 41.0 40.0 41.0 37.5 41.0 28-29 39.5065 41.0 40.0 41.0 37.0 41.0 30-31 39.385999999999996 41.0 40.0 41.0 37.0 41.0 32-33 39.434375 41.0 40.0 41.0 36.5 41.0 34-35 39.39475 41.0 40.0 41.0 36.5 41.0 36-37 39.253 41.0 39.5 41.0 36.5 41.0 38-39 39.351 41.0 40.0 41.0 36.5 41.0 40-41 39.017125 40.5 39.0 41.0 35.5 41.0 42-43 39.004374999999996 41.0 39.0 41.0 35.5 41.0 44-45 39.08475 41.0 39.0 41.0 36.0 41.0 46-47 39.105375 41.0 39.0 41.0 36.0 41.0 48-49 39.062749999999994 41.0 39.0 41.0 35.5 41.0 50-51 38.863125 40.5 39.0 41.0 35.0 41.0 52-53 38.709875 40.0 39.0 41.0 35.0 41.0 54-55 38.617 40.0 38.5 41.0 35.0 41.0 56-57 38.546875 40.0 38.0 41.0 35.0 41.0 58-59 38.101625 40.0 37.5 41.0 34.0 41.0 60-61 37.758125 40.0 37.0 41.0 34.0 41.0 62-63 37.449 39.5 36.5 41.0 33.5 41.0 64-65 36.90275 39.0 36.0 40.5 32.0 41.0 66-67 36.826 38.5 35.0 40.0 32.5 41.0 68-69 36.367875 37.5 35.0 40.0 32.0 41.0 70-71 35.88 37.0 35.0 39.5 31.5 41.0 72-73 35.426500000000004 36.5 35.0 39.0 31.0 40.5 74-75 35.031125 36.0 35.0 38.5 31.0 40.0 76-77 33.971000000000004 35.0 33.5 37.0 29.5 39.0 78-79 34.230125 35.0 34.0 37.0 30.5 39.0 80-81 34.029375 35.0 34.0 36.5 31.0 38.5 82-83 33.796499999999995 35.0 34.0 36.0 31.0 37.0 84-85 33.46725 35.0 34.0 36.0 30.0 37.0 86-87 33.259625 35.0 34.0 35.0 30.0 36.5 88-89 32.988749999999996 35.0 34.0 35.0 30.0 36.0 90-91 32.8575 35.0 34.0 35.0 30.0 36.0 92-93 32.648375 35.0 34.0 35.0 29.5 36.0 94-95 32.42125 35.0 34.0 35.0 29.0 35.5 96-97 32.158249999999995 35.0 33.5 35.0 28.0 35.0 98-99 32.018375 35.0 33.0 35.0 28.0 35.0 100 31.9835 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 2.0 10 1.0 11 2.0 12 4.0 13 5.0 14 2.0 15 6.0 16 7.0 17 5.0 18 7.0 19 4.0 20 5.0 21 9.0 22 12.0 23 11.0 24 11.0 25 12.0 26 18.0 27 23.0 28 26.0 29 28.0 30 31.0 31 37.0 32 64.0 33 74.0 34 103.0 35 170.0 36 340.0 37 857.0 38 1770.0 39 351.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.05 15.775 18.775 41.4 2 19.125 25.85 35.099999999999994 19.925 3 22.275 27.500000000000004 26.674999999999997 23.549999999999997 4 23.875 33.525 20.025000000000002 22.575 5 24.45 34.675 22.85 18.025 6 19.275000000000002 37.15 24.05 19.525000000000002 7 17.224999999999998 18.95 43.35 20.474999999999998 8 18.875 24.2 31.15 25.775 9 20.575 24.125 31.2 24.099999999999998 10-11 23.45 33.225 21.9625 21.3625 12-13 20.7625 26.937499999999996 29.4125 22.8875 14-15 21.555388847211805 28.66966741685421 28.857214303575894 20.91772943235809 16-17 22.625 28.675 26.987499999999997 21.712500000000002 18-19 22.15 28.849999999999998 27.525 21.475 20-21 22.1375 28.825 27.3625 21.675 22-23 20.65 29.8375 27.1625 22.35 24-25 21.2625 28.762500000000003 27.6 22.375 26-27 21.0125 28.262500000000003 28.7375 21.987499999999997 28-29 22.425 28.075 27.6875 21.8125 30-31 21.462500000000002 28.5875 27.6625 22.287499999999998 32-33 21.8875 28.3125 28.712500000000002 21.087500000000002 34-35 21.212500000000002 27.875 28.4125 22.5 36-37 22.162499999999998 28.962500000000002 26.7125 22.162499999999998 38-39 22.775000000000002 28.6125 27.3625 21.25 40-41 21.1875 28.349999999999998 28.299999999999997 22.162499999999998 42-43 22.0875 27.650000000000002 28.65 21.6125 44-45 22.6375 27.9375 27.725 21.7 46-47 21.462500000000002 28.487499999999997 28.275 21.775 48-49 21.625 27.6375 28.575 22.162499999999998 50-51 22.00275034379297 27.97849731216402 28.678584823102888 21.340167520940117 52-53 22.018004501125283 27.894473618404604 28.832208052013 21.255313828457115 54-55 22.3125 28.1 28.4 21.1875 56-57 21.85 28.487499999999997 28.237499999999997 21.425 58-59 21.275 28.775000000000002 28.012500000000003 21.9375 60-61 22.4625 27.762500000000003 28.762500000000003 21.0125 62-63 23.6625 27.5125 27.725 21.099999999999998 64-65 22.3875 28.825 27.712500000000002 21.075 66-67 21.325 28.9 28.025 21.75 68-69 22.175 28.237499999999997 27.6875 21.9 70-71 21.6 27.650000000000002 28.262500000000003 22.4875 72-73 22.2125 28.3625 28.3875 21.0375 74-75 21.65 28.262500000000003 27.55 22.537499999999998 76-77 22.325 28.1125 27.762500000000003 21.8 78-79 22.425 27.650000000000002 27.8875 22.037499999999998 80-81 22.375 28.9 27.0875 21.637500000000003 82-83 22.112499999999997 28.15 28.1375 21.6 84-85 21.9625 27.675 27.375 22.9875 86-87 20.837500000000002 29.462500000000002 28.075 21.625 88-89 21.875 28.449999999999996 28.325 21.349999999999998 90-91 22.0625 28.3375 27.675 21.925 92-93 21.725 28.762500000000003 27.85 21.6625 94-95 21.8625 29.1125 27.9375 21.087500000000002 96-97 21.45 28.175 28.512500000000003 21.8625 98-99 21.425 28.9375 27.762500000000003 21.875 100 21.325 28.475 28.199999999999996 22.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 3.0 25 5.5 26 10.0 27 10.0 28 13.0 29 17.5 30 22.0 31 31.0 32 42.5 33 55.0 34 67.5 35 79.5 36 95.0 37 113.0 38 135.0 39 164.5 40 210.0 41 242.5 42 232.0 43 242.0 44 261.5 45 274.5 46 277.0 47 239.0 48 196.0 49 169.0 50 152.0 51 129.0 52 108.0 53 92.0 54 75.5 55 52.0 56 34.5 57 28.0 58 24.0 59 20.5 60 16.0 61 15.5 62 11.0 63 7.0 64 6.0 65 4.0 66 2.0 67 2.5 68 1.5 69 1.0 70 2.0 71 1.5 72 1.0 73 0.5 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.025 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0125 52-53 0.025 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.824517422913 99.55000000000001 2 0.12534469791927802 0.25 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0250689395838556 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGTAATCTCGTAT 5 0.125 TruSeq Adapter, Index 22 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1375 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.16249999999999998 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.175 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.1875 0.0 0.0 0.0 0.0 44-45 0.2 0.0 0.0 0.0 0.0 46-47 0.2 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.2 0.0 0.0 0.0 0.0 54-55 0.2 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139459 spots for SRR3207819.sra Written 1139459 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra Read 1139448 spots for SRR3207819.sra Written 1139448 spots for SRR3207819.sra SRR ids: ['SRR3207819.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_deonrv1k SRR3207819.sra spots: 22788971 blocks: [[1, 1139448], [1139449, 2278896], [2278897, 3418344], [3418345, 4557792], [4557793, 5697240], [5697241, 6836688], [6836689, 7976136], [7976137, 9115584], [9115585, 10255032], [10255033, 11394480], [11394481, 12533928], [12533929, 13673376], [13673377, 14812824], [14812825, 15952272], [15952273, 17091720], [17091721, 18231168], [18231169, 19370616], [19370617, 20510064], [20510065, 21649512], [21649513, 22788971]] SRR3207819 file size 5919783 SRR3207819 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207819 SRR3207819_1.fastq Input file: SRR3207819_1.fastq trimmed: SRR3207819-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 00:50:18 2025 >> started Tue Feb 11 00:50:31 2025 >> done (13.015s) 22788971 reads processed; of these: 4893 ( 0.02%) short reads filtered out after trimming by size control 54521 ( 0.24%) empty reads filtered out after trimming by size control 22729557 (99.74%) reads available; of these: 2225831 ( 9.79%) trimmed reads available after processing 20503726 (90.21%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 895 0.00% 19 1048 0.00% 20 1384 0.01% 21 1734 0.01% 22 2207 0.01% 23 3021 0.01% 24 3952 0.02% 25 5291 0.02% 26 5022 0.02% 27 4850 0.02% 28 5098 0.02% 29 4888 0.02% 30 4911 0.02% 31 4976 0.02% 32 5199 0.02% 33 5400 0.02% 34 5762 0.03% 35 5912 0.03% 36 6279 0.03% 37 6738 0.03% 38 6929 0.03% 39 7264 0.03% 40 7817 0.03% 41 8030 0.04% 42 8611 0.04% 43 9110 0.04% 44 9783 0.04% 45 9937 0.04% 46 10180 0.04% 47 10598 0.05% 48 11670 0.05% 49 12099 0.05% 50 12976 0.06% 51 13282 0.06% 52 13590 0.06% 53 14504 0.06% 54 15712 0.07% 55 16084 0.07% 56 17084 0.08% 57 17384 0.08% 58 17863 0.08% 59 17588 0.08% 60 18258 0.08% 61 18221 0.08% 62 18184 0.08% 63 18670 0.08% 64 18799 0.08% 65 18554 0.08% 66 19038 0.08% 67 19810 0.09% 68 19974 0.09% 69 20231 0.09% 70 21019 0.09% 71 21789 0.10% 72 21879 0.10% 73 22646 0.10% 74 22925 0.10% 75 22462 0.10% 76 16155 0.07% 77 18534 0.08% 78 21300 0.09% 79 23326 0.10% 80 25399 0.11% 81 27313 0.12% 82 29835 0.13% 83 32280 0.14% 84 34171 0.15% 85 37387 0.16% 86 40954 0.18% 87 42747 0.19% 88 45133 0.20% 89 49014 0.22% 90 54765 0.24% 91 60861 0.27% 92 68904 0.30% 93 77139 0.34% 94 91835 0.40% 95 109374 0.48% 96 129473 0.57% 97 154371 0.68% 98 182392 0.80% 99 178048 0.78% 100 20503726 90.21% 22729557 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=14.10 fanout-score-rank=14 prefix-density=0.10 prefix-fanout=14.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGTAATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=16 fanout-score=297.47 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=28.3 sequence=TTCTTCTTCTTC Started job on | Feb 11 00:50:56 Started mapping on | Feb 11 00:50:56 Finished on | Feb 11 00:51:28 Mapping speed, Million of reads per hour | 2557.08 Number of input reads | 22729557 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 20775489 Uniquely mapped reads % | 91.40% Average mapped length | 97.92 Number of splices: Total | 5708438 Number of splices: Annotated (sjdb) | 5592034 Number of splices: GT/AG | 5617466 Number of splices: GC/AG | 73128 Number of splices: AT/AC | 6060 Number of splices: Non-canonical | 11784 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 1.97 Insertion rate per base | 0.01% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 510062 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 296880 % of reads mapped to too many loci | 1.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.03% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1444006 1444006 1444006 N_multimapping 510062 510062 510062 N_noFeature 1037857 10833150 10827468 N_ambiguous 228739 37483 38845 UnstrandedReadsAssigned:19508893 PositiveStrandReadsAssigned:9904856 NegativeStrandReadsAssigned:9909176 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207819 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207819-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,729,557 reads, 20,194,578 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,282 rounds 52401 SRR3207819.ke.tsv 34699 SRR3207819.se.tsv 87100 total ==> SRR3207819.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 800 30.0043 Potri.005G024800.1.v4.1 1035 936 209 16.0709 Potri.004G059700.1.v4.1 961 862 25 2.08738 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 327.579 8.29 Potri.016G087400.1.v4.1 270 171 793 333.769 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 128 5.5033 Potri.012G127500.1.v4.1 977 878 3433 281.415 ==> SRR3207819.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2497 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 405 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207819 completed mapping pipeline successfully