Starting /dee2/code/volunteer_pipeline.sh SRR3207820 current disk space = 3056972771328 free memory = 1476225308 SRR3207820 SRAfilesize 78b00cdaf95edfa02a5c6413e5d2d7ca SRR3207820.sra SRR3207820.sra file validated SRR3207820 is single end SRR3207820 is conventional basespace SRR3207820 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207820_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04175 34.0 33.0 34.0 31.0 34.0 2 33.27875 34.0 34.0 34.0 31.0 34.0 3 33.367 34.0 34.0 34.0 31.0 34.0 4 36.57325 37.0 37.0 37.0 35.0 37.0 5 36.4625 37.0 37.0 37.0 35.0 37.0 6 36.54175 37.0 37.0 37.0 35.0 37.0 7 36.5515 37.0 37.0 37.0 35.0 37.0 8 36.57075 37.0 37.0 37.0 35.0 37.0 9 38.447 39.0 39.0 39.0 37.0 39.0 10-11 38.3795 39.0 39.0 39.0 37.0 39.0 12-13 38.35425 39.0 39.0 39.0 37.0 39.0 14-15 39.902125 41.0 40.0 41.0 38.0 41.0 16-17 39.904625 41.0 40.0 41.0 38.0 41.0 18-19 39.937875 41.0 40.0 41.0 38.0 41.0 20-21 39.868375 41.0 40.0 41.0 38.0 41.0 22-23 39.807874999999996 41.0 40.0 41.0 38.0 41.0 24-25 39.7825 41.0 40.0 41.0 38.0 41.0 26-27 39.7205 41.0 40.0 41.0 37.5 41.0 28-29 39.60725 41.0 40.0 41.0 37.5 41.0 30-31 39.454875 41.0 40.0 41.0 36.5 41.0 32-33 39.55525 41.0 40.0 41.0 37.0 41.0 34-35 39.541 41.0 40.0 41.0 37.0 41.0 36-37 39.230500000000006 41.0 39.5 41.0 36.0 41.0 38-39 39.341750000000005 41.0 39.0 41.0 36.5 41.0 40-41 38.905375 40.0 39.0 41.0 35.0 41.0 42-43 39.126125 40.5 39.0 41.0 35.5 41.0 44-45 39.220124999999996 41.0 39.0 41.0 36.0 41.0 46-47 39.278125 41.0 39.0 41.0 36.0 41.0 48-49 39.281125 41.0 39.0 41.0 36.0 41.0 50-51 39.106125 41.0 39.0 41.0 35.5 41.0 52-53 38.8955 40.0 39.0 41.0 35.0 41.0 54-55 38.74225 40.0 38.5 41.0 35.0 41.0 56-57 38.653499999999994 40.0 38.0 41.0 35.0 41.0 58-59 38.335750000000004 40.0 38.0 41.0 34.5 41.0 60-61 38.05275 40.0 37.0 41.0 34.0 41.0 62-63 37.647625000000005 39.5 36.5 41.0 33.5 41.0 64-65 37.161249999999995 39.0 36.0 41.0 32.5 41.0 66-67 37.084875 39.0 36.0 40.5 33.0 41.0 68-69 36.5985 37.5 35.0 40.0 32.5 41.0 70-71 36.25025 37.0 35.0 39.5 32.0 41.0 72-73 35.676249999999996 37.0 35.0 39.0 31.0 40.5 74-75 35.151624999999996 36.0 34.5 38.5 31.0 39.5 76-77 34.16675 35.0 33.5 37.0 30.0 39.0 78-79 34.473375000000004 35.0 34.0 37.0 31.0 39.0 80-81 34.3025 35.0 34.0 36.5 31.0 38.5 82-83 34.0945 35.0 34.0 36.0 31.5 37.0 84-85 33.69425 35.0 34.0 36.0 31.0 37.0 86-87 33.4535 35.0 34.0 35.0 30.5 36.5 88-89 33.18 35.0 34.0 35.0 30.5 36.0 90-91 33.074875 35.0 34.0 35.0 30.0 36.0 92-93 32.89175 35.0 34.0 35.0 30.0 36.0 94-95 32.731625 35.0 34.0 35.0 30.0 35.0 96-97 32.460750000000004 35.0 33.5 35.0 29.5 35.0 98-99 32.264375 35.0 33.0 35.0 29.0 35.0 100 32.22275 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 1.0 11 2.0 12 2.0 13 2.0 14 2.0 15 2.0 16 3.0 17 5.0 18 5.0 19 6.0 20 7.0 21 6.0 22 3.0 23 11.0 24 4.0 25 13.0 26 17.0 27 20.0 28 34.0 29 23.0 30 36.0 31 46.0 32 50.0 33 76.0 34 94.0 35 171.0 36 333.0 37 899.0 38 1750.0 39 374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.3 15.5 17.150000000000002 41.05 2 20.0 23.45 35.975 20.575 3 22.15 27.025 25.5 25.324999999999996 4 24.625 32.75 20.125 22.5 5 23.25 35.475 22.275 19.0 6 18.95 37.15 24.95 18.95 7 16.175 19.55 42.675000000000004 21.6 8 19.075 23.400000000000002 30.025000000000002 27.500000000000004 9 20.075000000000003 23.825 31.674999999999997 24.425 10-11 21.8625 33.2625 24.025 20.849999999999998 12-13 20.0 26.325 29.45 24.224999999999998 14-15 20.740555416562422 28.108581436077056 28.233675256442332 22.91718789091819 16-17 22.45 28.0625 27.8375 21.65 18-19 22.4625 29.125 26.8375 21.575 20-21 21.5 29.062500000000004 27.750000000000004 21.6875 22-23 21.212500000000002 28.8875 27.200000000000003 22.7 24-25 21.4 28.6125 28.3875 21.6 26-27 21.9625 28.625 27.2625 22.15 28-29 21.85 28.537499999999998 27.1 22.5125 30-31 21.575 28.0875 27.725 22.6125 32-33 21.9375 28.425 27.150000000000002 22.4875 34-35 21.212500000000002 28.7375 28.000000000000004 22.05 36-37 21.762500000000003 28.249999999999996 27.525 22.4625 38-39 21.45 28.275 28.225 22.05 40-41 21.6625 28.525 28.15 21.6625 42-43 21.0125 27.8125 28.825 22.35 44-45 21.475 27.787499999999998 28.712500000000002 22.025 46-47 22.0125 27.5625 28.3875 22.037499999999998 48-49 21.1625 28.762500000000003 27.825 22.25 50-51 20.480420367821843 29.150506693356686 28.887776804704117 21.481296134117354 52-53 21.336503566512327 28.732323864347393 27.968965085721436 21.962207483418847 54-55 21.637500000000003 28.975 27.787499999999998 21.6 56-57 21.9625 27.537499999999998 28.7 21.8 58-59 22.400000000000002 28.425 27.0875 22.0875 60-61 21.575 27.787499999999998 29.1375 21.5 62-63 21.675 28.8375 27.3125 22.175 64-65 22.5 27.675 28.425 21.4 66-67 23.3125 27.375 28.4375 20.875 68-69 22.2625 28.275 27.037499999999998 22.425 70-71 21.762500000000003 29.262500000000003 27.3125 21.6625 72-73 22.1 28.9875 27.6875 21.224999999999998 74-75 21.9625 29.1125 28.449999999999996 20.474999999999998 76-77 21.4125 28.537499999999998 28.212500000000002 21.837500000000002 78-79 21.8625 28.3875 28.3875 21.3625 80-81 21.637500000000003 29.525000000000002 26.75 22.0875 82-83 22.525000000000002 28.5875 26.987499999999997 21.9 84-85 21.7875 28.0875 28.037499999999998 22.0875 86-87 22.125 28.375 27.962500000000002 21.5375 88-89 22.255563890972745 28.069517379344838 28.54463615903976 21.13028257064266 90-91 22.466850137603203 28.096072054040533 27.89592194145609 21.541155866900176 92-93 21.9625 28.012500000000003 28.1875 21.837500000000002 94-95 22.275 27.975 28.325 21.425 96-97 22.650000000000002 28.4 27.6125 21.337500000000002 98-99 23.2375 28.549999999999997 27.5125 20.7 100 22.650000000000002 28.425 27.325 21.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 3.5 24 4.5 25 4.5 26 6.0 27 9.5 28 12.5 29 18.0 30 20.0 31 27.0 32 43.5 33 46.0 34 54.0 35 80.5 36 101.0 37 120.0 38 149.0 39 173.0 40 196.0 41 214.5 42 230.5 43 251.5 44 261.0 45 272.0 46 265.5 47 239.5 48 226.0 49 197.0 50 154.5 51 130.0 52 107.0 53 86.0 54 67.0 55 49.0 56 35.5 57 21.5 58 18.0 59 22.0 60 16.5 61 8.0 62 12.0 63 12.5 64 6.0 65 3.0 66 2.0 67 2.0 68 1.0 69 1.5 70 1.5 71 1.0 72 2.5 73 2.0 74 1.0 75 3.0 76 2.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.075 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.08750000000000001 52-53 0.11249999999999999 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.025 90-91 0.075 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72368751569958 99.25 2 0.25119316754584275 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025119316754584273 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTAT 10 0.25 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565247 spots for SRR3207820.sra Written 1565247 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra Read 1565240 spots for SRR3207820.sra Written 1565240 spots for SRR3207820.sra SRR ids: ['SRR3207820.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zxuqpfok SRR3207820.sra spots: 31304807 blocks: [[1, 1565240], [1565241, 3130480], [3130481, 4695720], [4695721, 6260960], [6260961, 7826200], [7826201, 9391440], [9391441, 10956680], [10956681, 12521920], [12521921, 14087160], [14087161, 15652400], [15652401, 17217640], [17217641, 18782880], [18782881, 20348120], [20348121, 21913360], [21913361, 23478600], [23478601, 25043840], [25043841, 26609080], [26609081, 28174320], [28174321, 29739560], [29739561, 31304807]] SRR3207820 file size 8135959 SRR3207820 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207820 SRR3207820_1.fastq Input file: SRR3207820_1.fastq trimmed: SRR3207820-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 02:57:15 2025 >> started Tue Feb 11 03:03:24 2025 >> done (369.130s) 31304807 reads processed; of these: 6609 ( 0.02%) short reads filtered out after trimming by size control 94574 ( 0.30%) empty reads filtered out after trimming by size control 31203624 (99.68%) reads available; of these: 3063558 ( 9.82%) trimmed reads available after processing 28140066 (90.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1272 0.00% 19 1449 0.00% 20 1830 0.01% 21 2266 0.01% 22 3167 0.01% 23 4122 0.01% 24 5355 0.02% 25 7166 0.02% 26 6835 0.02% 27 6833 0.02% 28 6871 0.02% 29 6987 0.02% 30 6845 0.02% 31 6787 0.02% 32 7161 0.02% 33 7485 0.02% 34 7796 0.02% 35 7968 0.03% 36 8894 0.03% 37 9459 0.03% 38 9610 0.03% 39 10138 0.03% 40 10638 0.03% 41 10978 0.04% 42 11814 0.04% 43 12438 0.04% 44 13384 0.04% 45 13636 0.04% 46 14043 0.05% 47 14970 0.05% 48 15557 0.05% 49 16654 0.05% 50 17786 0.06% 51 17951 0.06% 52 18565 0.06% 53 20106 0.06% 54 21647 0.07% 55 22021 0.07% 56 23396 0.07% 57 24104 0.08% 58 25034 0.08% 59 24157 0.08% 60 24498 0.08% 61 24847 0.08% 62 24901 0.08% 63 25516 0.08% 64 25496 0.08% 65 25899 0.08% 66 26339 0.08% 67 26943 0.09% 68 27537 0.09% 69 27864 0.09% 70 29048 0.09% 71 30024 0.10% 72 30603 0.10% 73 31009 0.10% 74 31435 0.10% 75 30879 0.10% 76 22349 0.07% 77 25812 0.08% 78 28722 0.09% 79 31896 0.10% 80 34513 0.11% 81 37709 0.12% 82 40936 0.13% 83 44577 0.14% 84 46924 0.15% 85 51404 0.16% 86 56180 0.18% 87 58735 0.19% 88 62460 0.20% 89 67882 0.22% 90 75398 0.24% 91 83817 0.27% 92 95016 0.30% 93 106715 0.34% 94 126468 0.41% 95 150838 0.48% 96 179297 0.57% 97 213241 0.68% 98 251028 0.80% 99 243628 0.78% 100 28140066 90.18% 31203624 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=10.61 fanout-score-rank=19 prefix-density=0.06 prefix-fanout=10.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=284.15 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=27.9 sequence=TTCTTCTTCTTT Started job on | Feb 11 03:20:02 Started mapping on | Feb 11 03:20:16 Finished on | Feb 11 04:59:16 Mapping speed, Million of reads per hour | 18.91 Number of input reads | 31203624 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 28060718 Uniquely mapped reads % | 89.93% Average mapped length | 97.97 Number of splices: Total | 7823725 Number of splices: Annotated (sjdb) | 7660005 Number of splices: GT/AG | 7704857 Number of splices: GC/AG | 95886 Number of splices: AT/AC | 7780 Number of splices: Non-canonical | 15202 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 1.95 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 719571 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 615763 % of reads mapped to too many loci | 1.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.78% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2423335 2423335 2423335 N_multimapping 719571 719571 719571 N_noFeature 1500453 14695987 14655621 N_ambiguous 314758 52274 53407 UnstrandedReadsAssigned:26245507 PositiveStrandReadsAssigned:13312457 NegativeStrandReadsAssigned:13351690 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207820 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207820-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,203,624 reads, 27,389,948 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR3207820.ke.tsv 34699 SRR3207820.se.tsv 87100 total ==> SRR3207820.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1304 36.9116 Potri.005G024800.1.v4.1 1035 936 340 19.7316 Potri.004G059700.1.v4.1 961 862 17 1.07128 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 480.235 9.17243 Potri.016G087400.1.v4.1 270 171 871 276.683 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 82 2.66084 Potri.012G127500.1.v4.1 977 878 2040 126.211 ==> SRR3207820.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1670 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 455 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 27 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR3207820 completed mapping pipeline successfully