Starting /dee2/code/volunteer_pipeline.sh SRR3207821 current disk space = 3056950947840 free memory = 1508877788 SRR3207821 SRAfilesize 96eb220dda61ef1c5032a37729f7cdfb SRR3207821.sra SRR3207821.sra file validated SRR3207821 is single end SRR3207821 is conventional basespace SRR3207821 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207821_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04775 34.0 33.0 34.0 31.0 34.0 2 33.24575 34.0 33.0 34.0 31.0 34.0 3 33.3485 34.0 34.0 34.0 31.0 34.0 4 36.53175 37.0 37.0 37.0 35.0 37.0 5 36.44425 37.0 37.0 37.0 35.0 37.0 6 36.51425 37.0 37.0 37.0 35.0 37.0 7 36.55975 37.0 37.0 37.0 35.0 37.0 8 36.56125 37.0 37.0 37.0 35.0 37.0 9 38.43775 39.0 39.0 39.0 37.0 39.0 10-11 38.395624999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.359 39.0 39.0 39.0 37.0 39.0 14-15 39.918499999999995 41.0 40.0 41.0 38.0 41.0 16-17 39.812 41.0 40.0 41.0 38.0 41.0 18-19 39.879374999999996 41.0 40.0 41.0 38.0 41.0 20-21 39.864000000000004 41.0 40.0 41.0 38.0 41.0 22-23 39.826375 41.0 40.0 41.0 38.0 41.0 24-25 39.790875 41.0 40.0 41.0 38.0 41.0 26-27 39.687875000000005 41.0 40.0 41.0 38.0 41.0 28-29 39.448125000000005 41.0 40.0 41.0 37.0 41.0 30-31 39.421875 41.0 40.0 41.0 37.0 41.0 32-33 39.520125 41.0 40.0 41.0 37.0 41.0 34-35 39.436125000000004 41.0 40.0 41.0 36.5 41.0 36-37 39.29925 41.0 40.0 41.0 36.5 41.0 38-39 39.334500000000006 41.0 40.0 41.0 36.5 41.0 40-41 39.040625 40.5 39.0 41.0 35.5 41.0 42-43 39.045249999999996 41.0 39.0 41.0 36.0 41.0 44-45 39.118624999999994 41.0 39.0 41.0 36.0 41.0 46-47 39.208749999999995 41.0 39.0 41.0 36.0 41.0 48-49 39.181875000000005 41.0 39.0 41.0 36.0 41.0 50-51 38.93575 41.0 39.0 41.0 35.0 41.0 52-53 38.768249999999995 40.0 39.0 41.0 35.0 41.0 54-55 38.680625 40.0 38.5 41.0 35.0 41.0 56-57 38.52275 40.0 38.0 41.0 35.0 41.0 58-59 38.145625 40.0 37.5 41.0 34.0 41.0 60-61 37.87575 40.0 37.0 41.0 34.0 41.0 62-63 37.608875 39.5 36.5 41.0 33.5 41.0 64-65 37.054875 39.0 36.0 41.0 33.0 41.0 66-67 36.925124999999994 39.0 35.5 40.0 33.0 41.0 68-69 36.3985 37.5 35.0 40.0 32.0 41.0 70-71 35.99975 37.0 35.0 39.5 31.5 41.0 72-73 35.568875000000006 36.5 35.0 39.0 31.5 40.5 74-75 35.181749999999994 36.0 35.0 38.5 31.5 40.0 76-77 34.1425 35.0 33.5 37.0 30.0 39.0 78-79 34.434124999999995 35.0 34.0 37.0 31.0 39.0 80-81 34.28337500000001 35.0 34.0 37.0 31.0 39.0 82-83 33.976124999999996 35.0 34.0 36.0 31.0 37.0 84-85 33.566625 35.0 34.0 36.0 30.5 37.0 86-87 33.341875 35.0 34.0 35.0 30.0 36.5 88-89 33.096875 35.0 34.0 35.0 30.0 36.0 90-91 33.050250000000005 35.0 34.0 35.0 30.5 36.0 92-93 32.881625 35.0 34.0 35.0 30.0 36.0 94-95 32.668625 35.0 34.0 35.0 30.0 35.5 96-97 32.2435 35.0 33.5 35.0 29.0 35.0 98-99 32.142625 35.0 33.0 35.0 29.0 35.0 100 31.988 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 2.0 8 3.0 9 3.0 10 1.0 11 2.0 12 2.0 13 2.0 14 6.0 15 1.0 16 8.0 17 3.0 18 6.0 19 6.0 20 7.0 21 9.0 22 7.0 23 5.0 24 7.0 25 4.0 26 26.0 27 25.0 28 14.0 29 31.0 30 31.0 31 40.0 32 46.0 33 65.0 34 123.0 35 149.0 36 335.0 37 939.0 38 1706.0 39 383.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.650000000000002 16.775000000000002 15.5 41.075 2 18.525 24.975 37.025000000000006 19.475 3 21.425 27.775 26.75 24.05 4 23.200000000000003 32.475 22.3 22.025 5 24.637318659329665 33.81690845422711 24.037018509254626 17.508754377188595 6 18.85 38.025 24.15 18.975 7 16.7 18.625 42.9 21.775 8 19.675 23.400000000000002 30.825000000000003 26.1 9 21.2 22.6 30.4 25.8 10-11 23.0375 33.375 22.5875 21.0 12-13 20.375 27.425 29.5375 22.662499999999998 14-15 21.017754438609654 27.74443610902726 29.132283070767688 22.1055263815954 16-17 21.512500000000003 28.3375 27.750000000000004 22.400000000000002 18-19 21.212500000000002 28.487499999999997 28.175 22.125 20-21 21.675 28.487499999999997 28.425 21.4125 22-23 21.8 28.549999999999997 28.000000000000004 21.65 24-25 21.0 28.8625 28.1375 22.0 26-27 21.099999999999998 29.099999999999998 27.487499999999997 22.3125 28-29 22.1375 28.199999999999996 27.900000000000002 21.762500000000003 30-31 21.2875 28.999999999999996 28.5625 21.15 32-33 22.112499999999997 28.3375 27.187499999999996 22.3625 34-35 21.5625 27.925 28.8625 21.65 36-37 22.225 28.075 27.5625 22.1375 38-39 21.4875 28.549999999999997 28.575 21.3875 40-41 21.6 27.675 28.212500000000002 22.5125 42-43 20.95 27.487499999999997 29.1125 22.45 44-45 21.9375 29.3375 27.625 21.099999999999998 46-47 22.2125 27.9375 28.15 21.7 48-49 22.675 28.0625 27.775 21.4875 50-51 21.503627720790593 29.246935201401055 27.570678008506377 21.678759069301975 52-53 21.46164434989363 29.03266174446252 28.48204229758478 21.023651608059065 54-55 21.375 28.6375 27.6875 22.3 56-57 21.4 28.125 27.875 22.6 58-59 21.025 28.199999999999996 29.062500000000004 21.712500000000002 60-61 21.224999999999998 27.6 28.775000000000002 22.400000000000002 62-63 21.5625 27.712500000000002 28.037499999999998 22.6875 64-65 22.1 28.299999999999997 28.9875 20.6125 66-67 21.7875 28.6125 27.474999999999998 22.125 68-69 21.275 28.5625 28.012500000000003 22.15 70-71 23.025000000000002 27.500000000000004 28.3875 21.087500000000002 72-73 21.425 28.349999999999998 27.712500000000002 22.5125 74-75 21.1125 27.8125 28.9125 22.162499999999998 76-77 22.45 27.950000000000003 27.6125 21.987499999999997 78-79 21.224999999999998 28.8375 27.650000000000002 22.287499999999998 80-81 21.4125 27.55 28.5625 22.475 82-83 22.05 27.6375 28.3375 21.975 84-85 21.224999999999998 27.8875 29.0875 21.8 86-87 21.55 28.65 28.1625 21.637500000000003 88-89 21.495560835313242 28.03551331749406 28.298111791921972 22.170814055270725 90-91 22.266700025018764 27.62071553665249 28.75906930197648 21.353515136352264 92-93 21.65 28.012500000000003 28.95 21.3875 94-95 22.35 28.075 27.987499999999997 21.587500000000002 96-97 21.8625 27.212500000000002 28.825 22.1 98-99 20.837500000000002 28.3125 29.125 21.725 100 21.15 27.800000000000004 29.75 21.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 2.0 21 2.5 22 2.0 23 2.5 24 5.5 25 8.0 26 10.0 27 14.0 28 18.5 29 19.0 30 21.0 31 35.5 32 49.0 33 52.5 34 64.0 35 78.5 36 92.0 37 120.0 38 149.5 39 174.0 40 194.5 41 202.0 42 233.5 43 261.0 44 251.5 45 260.5 46 260.5 47 230.0 48 215.5 49 202.0 50 160.0 51 123.0 52 105.0 53 84.0 54 58.5 55 43.0 56 44.0 57 36.0 58 22.0 59 17.0 60 15.5 61 12.5 62 7.0 63 6.0 64 4.5 65 3.5 66 3.5 67 3.5 68 3.0 69 2.0 70 2.0 71 2.5 72 2.0 73 0.5 74 0.0 75 0.5 76 1.0 77 0.5 78 0.5 79 1.0 80 1.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.025 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.075 52-53 0.11249999999999999 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0375 90-91 0.075 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.037500000000000006 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839070 spots for SRR3207821.sra Written 839070 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra Read 839060 spots for SRR3207821.sra Written 839060 spots for SRR3207821.sra SRR ids: ['SRR3207821.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b5exxwoz SRR3207821.sra spots: 16781210 blocks: [[1, 839060], [839061, 1678120], [1678121, 2517180], [2517181, 3356240], [3356241, 4195300], [4195301, 5034360], [5034361, 5873420], [5873421, 6712480], [6712481, 7551540], [7551541, 8390600], [8390601, 9229660], [9229661, 10068720], [10068721, 10907780], [10907781, 11746840], [11746841, 12585900], [12585901, 13424960], [13424961, 14264020], [14264021, 15103080], [15103081, 15942140], [15942141, 16781210]] SRR3207821 file size 4356311 SRR3207821 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207821 SRR3207821_1.fastq Input file: SRR3207821_1.fastq trimmed: SRR3207821-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 02:17:12 2025 >> started Tue Feb 11 02:27:54 2025 >> done (642.461s) 16781210 reads processed; of these: 3307 ( 0.02%) short reads filtered out after trimming by size control 24607 ( 0.15%) empty reads filtered out after trimming by size control 16753296 (99.83%) reads available; of these: 1634607 ( 9.76%) trimmed reads available after processing 15118689 (90.24%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 590 0.00% 19 785 0.00% 20 920 0.01% 21 1274 0.01% 22 1707 0.01% 23 2241 0.01% 24 2889 0.02% 25 3923 0.02% 26 3738 0.02% 27 3620 0.02% 28 3724 0.02% 29 3839 0.02% 30 3779 0.02% 31 3708 0.02% 32 3863 0.02% 33 3915 0.02% 34 4274 0.03% 35 4414 0.03% 36 4770 0.03% 37 5099 0.03% 38 5238 0.03% 39 5508 0.03% 40 5734 0.03% 41 5988 0.04% 42 6347 0.04% 43 6749 0.04% 44 7264 0.04% 45 7373 0.04% 46 7486 0.04% 47 7938 0.05% 48 8175 0.05% 49 8883 0.05% 50 9563 0.06% 51 9811 0.06% 52 10163 0.06% 53 10712 0.06% 54 11679 0.07% 55 11756 0.07% 56 12562 0.07% 57 12801 0.08% 58 13358 0.08% 59 13018 0.08% 60 13425 0.08% 61 13326 0.08% 62 13364 0.08% 63 13668 0.08% 64 13787 0.08% 65 13679 0.08% 66 14256 0.09% 67 14514 0.09% 68 15062 0.09% 69 14560 0.09% 70 15587 0.09% 71 15937 0.10% 72 16179 0.10% 73 16181 0.10% 74 16826 0.10% 75 16287 0.10% 76 11997 0.07% 77 13677 0.08% 78 15680 0.09% 79 17106 0.10% 80 18730 0.11% 81 20098 0.12% 82 21853 0.13% 83 24286 0.14% 84 24874 0.15% 85 27295 0.16% 86 30066 0.18% 87 31283 0.19% 88 33268 0.20% 89 35755 0.21% 90 40394 0.24% 91 44828 0.27% 92 50553 0.30% 93 56849 0.34% 94 67393 0.40% 95 80048 0.48% 96 94454 0.56% 97 113270 0.68% 98 133826 0.80% 99 129208 0.77% 100 15118689 90.24% 16753296 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=8.81 fanout-score-rank=18 prefix-density=0.05 prefix-fanout=8.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=273.41 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=27.6 sequence=TTCTTCTTCTTTT Started job on | Feb 11 02:46:25 Started mapping on | Feb 11 02:46:45 Finished on | Feb 11 04:17:11 Mapping speed, Million of reads per hour | 11.12 Number of input reads | 16753296 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 14658602 Uniquely mapped reads % | 87.50% Average mapped length | 97.98 Number of splices: Total | 3862610 Number of splices: Annotated (sjdb) | 3776817 Number of splices: GT/AG | 3802557 Number of splices: GC/AG | 48072 Number of splices: AT/AC | 3906 Number of splices: Non-canonical | 8075 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 1.93 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368880 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 264855 % of reads mapped to too many loci | 1.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.70% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1725814 1725814 1725814 N_multimapping 368880 368880 368880 N_noFeature 781240 7648701 7665034 N_ambiguous 180989 27273 27889 UnstrandedReadsAssigned:13696373 PositiveStrandReadsAssigned:6982628 NegativeStrandReadsAssigned:6965679 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207821 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207821-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,753,296 reads, 14,250,399 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52401 SRR3207821.ke.tsv 34699 SRR3207821.se.tsv 87100 total ==> SRR3207821.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 713 36.5683 Potri.005G024800.1.v4.1 1035 936 189 19.8736 Potri.004G059700.1.v4.1 961 862 13 1.48431 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 221.287 7.65801 Potri.016G087400.1.v4.1 270 171 472 271.666 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 39 2.29297 Potri.012G127500.1.v4.1 977 878 1677 187.987 ==> SRR3207821.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 777 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 230 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207821 completed mapping pipeline successfully