Starting /dee2/code/volunteer_pipeline.sh SRR3207822 current disk space = 3057238839296 free memory = 1341597976 SRR3207822 SRAfilesize 3320af731e2cf3ea24ba3e16623ae362 SRR3207822.sra SRR3207822.sra file validated SRR3207822 is single end SRR3207822 is conventional basespace SRR3207822 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207822_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0415 34.0 33.0 34.0 31.0 34.0 2 33.2415 34.0 33.0 34.0 31.0 34.0 3 33.35625 34.0 34.0 34.0 31.0 34.0 4 36.5865 37.0 37.0 37.0 35.0 37.0 5 36.4755 37.0 37.0 37.0 35.0 37.0 6 36.54825 37.0 37.0 37.0 35.0 37.0 7 36.5355 37.0 37.0 37.0 35.0 37.0 8 36.57475 37.0 37.0 37.0 35.0 37.0 9 38.4465 39.0 39.0 39.0 37.0 39.0 10-11 38.393249999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.368375 39.0 39.0 39.0 37.0 39.0 14-15 39.798249999999996 41.0 40.0 41.0 37.5 41.0 16-17 39.826 41.0 40.0 41.0 38.0 41.0 18-19 39.926625 41.0 40.0 41.0 38.0 41.0 20-21 39.896375 41.0 40.0 41.0 38.0 41.0 22-23 39.820499999999996 41.0 40.0 41.0 38.0 41.0 24-25 39.768125 41.0 40.0 41.0 38.0 41.0 26-27 39.712375 41.0 40.0 41.0 37.5 41.0 28-29 39.572500000000005 41.0 40.0 41.0 37.0 41.0 30-31 39.402 41.0 40.0 41.0 37.0 41.0 32-33 39.462 41.0 40.0 41.0 37.0 41.0 34-35 39.472875 41.0 40.0 41.0 37.0 41.0 36-37 39.2215 41.0 39.5 41.0 36.5 41.0 38-39 39.387625 41.0 40.0 41.0 37.0 41.0 40-41 39.036500000000004 41.0 39.0 41.0 35.5 41.0 42-43 39.098875 41.0 39.0 41.0 36.0 41.0 44-45 39.153875 41.0 39.0 41.0 36.0 41.0 46-47 39.240375 41.0 39.0 41.0 36.5 41.0 48-49 39.2355 41.0 39.0 41.0 36.0 41.0 50-51 39.046499999999995 41.0 39.0 41.0 35.5 41.0 52-53 38.849875 40.5 39.0 41.0 35.0 41.0 54-55 38.6965 40.0 38.5 41.0 35.0 41.0 56-57 38.572 40.0 38.0 41.0 35.0 41.0 58-59 38.1685 40.0 37.5 41.0 34.0 41.0 60-61 37.958 40.0 37.0 41.0 34.0 41.0 62-63 37.63175 39.5 36.5 41.0 33.5 41.0 64-65 37.087375 39.0 36.0 41.0 32.5 41.0 66-67 37.022625 39.0 36.0 40.0 33.0 41.0 68-69 36.524249999999995 38.0 35.0 40.0 32.0 41.0 70-71 36.093625 37.0 35.0 39.5 31.5 41.0 72-73 35.654624999999996 37.0 35.0 39.0 31.0 41.0 74-75 35.114875 36.0 35.0 39.0 31.0 40.0 76-77 34.07225 35.0 33.5 37.0 30.0 39.0 78-79 34.355125 35.0 34.0 37.0 31.0 39.0 80-81 34.205 35.0 34.0 37.0 31.0 38.5 82-83 33.934625 35.0 34.0 36.0 31.0 37.0 84-85 33.576125000000005 35.0 34.0 36.0 31.0 37.0 86-87 33.405375 35.0 34.0 35.5 31.0 36.5 88-89 33.1095 35.0 34.0 35.0 30.5 36.0 90-91 33.00175 35.0 34.0 35.0 30.5 36.0 92-93 32.853625 35.0 34.0 35.0 30.0 36.0 94-95 32.628125 35.0 34.0 35.0 29.5 35.5 96-97 32.226124999999996 35.0 33.5 35.0 28.0 35.0 98-99 32.138 35.0 33.0 35.0 29.0 35.0 100 32.04325 35.0 33.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 3.0 10 1.0 11 1.0 12 4.0 13 6.0 14 3.0 15 3.0 16 6.0 17 4.0 18 6.0 19 5.0 20 9.0 21 7.0 22 7.0 23 7.0 24 14.0 25 21.0 26 12.0 27 14.0 28 19.0 29 27.0 30 28.0 31 49.0 32 54.0 33 53.0 34 115.0 35 166.0 36 317.0 37 900.0 38 1739.0 39 398.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.424999999999997 15.85 15.725 42.0 2 19.475 25.05 36.25 19.225 3 20.925 28.175 26.325 24.575 4 24.125 32.95 21.15 21.775 5 24.025 36.3 22.175 17.5 6 18.5 37.7 25.25 18.55 7 16.8 19.05 43.35 20.8 8 19.45 24.875 29.575000000000003 26.1 9 19.675 23.400000000000002 31.624999999999996 25.3 10-11 22.6 33.95 22.287499999999998 21.1625 12-13 20.575 27.525 29.512500000000003 22.3875 14-15 20.40280210157618 27.833375031273455 29.10933199899925 22.654490868151115 16-17 21.2625 28.875 28.287499999999998 21.575 18-19 22.7125 28.4125 27.237499999999997 21.637500000000003 20-21 21.6875 29.549999999999997 27.375 21.3875 22-23 22.275 27.962500000000002 27.3875 22.375 24-25 20.599999999999998 28.825 28.125 22.45 26-27 21.0375 28.349999999999998 28.7375 21.875 28-29 21.275 28.287499999999998 28.000000000000004 22.4375 30-31 21.9 27.287499999999998 28.6375 22.175 32-33 21.05 29.1125 27.325 22.5125 34-35 21.3 28.325 28.499999999999996 21.875 36-37 21.15 28.799999999999997 27.725 22.325 38-39 21.1125 28.15 27.375 23.3625 40-41 22.162499999999998 28.125 28.6125 21.099999999999998 42-43 21.337500000000002 27.875 29.0875 21.7 44-45 21.65 28.1 28.525 21.725 46-47 21.8875 28.6625 27.6125 21.837500000000002 48-49 21.925 28.1625 27.6125 22.3 50-51 21.593894657825597 27.974477667959462 28.775178280995874 21.656449393219066 52-53 21.54924289826054 28.331873357527222 28.43198598423226 21.686897759979978 54-55 22.4875 27.55 28.012500000000003 21.95 56-57 21.675 28.475 27.8625 21.987499999999997 58-59 22.025 27.987499999999997 27.825 22.162499999999998 60-61 22.125 28.3625 27.3 22.2125 62-63 21.475 29.062500000000004 28.1375 21.325 64-65 22.7625 28.3375 27.35 21.55 66-67 20.349999999999998 29.012500000000003 28.3375 22.3 68-69 22.525000000000002 28.349999999999998 27.8625 21.2625 70-71 22.1375 28.7375 28.287499999999998 20.837500000000002 72-73 21.4375 28.762500000000003 27.6875 22.112499999999997 74-75 21.475 29.225 28.0875 21.212500000000002 76-77 21.4875 28.375 28.5625 21.575 78-79 20.875 28.762500000000003 29.262500000000003 21.099999999999998 80-81 21.1375 28.449999999999996 28.725 21.6875 82-83 20.9875 28.625 28.975 21.4125 84-85 21.337500000000002 27.762500000000003 28.449999999999996 22.45 86-87 21.1875 29.225 28.3375 21.25 88-89 22.7909887359199 27.83479349186483 28.3729662077597 21.00125156445557 90-91 21.639549436795996 28.5982478097622 27.434292866082604 22.327909887359198 92-93 21.57769721215152 28.6160770096262 27.953494186773348 21.852731591448933 94-95 21.2625 29.15 28.4375 21.15 96-97 22.05 28.0875 27.900000000000002 21.9625 98-99 22.162499999999998 28.7 27.762500000000003 21.375 100 20.75 28.425 28.825 22.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 2.5 23 4.5 24 8.0 25 8.0 26 5.5 27 8.0 28 15.0 29 22.5 30 26.5 31 34.5 32 43.0 33 52.0 34 66.5 35 84.5 36 102.5 37 121.0 38 148.5 39 169.0 40 189.5 41 215.0 42 243.5 43 266.0 44 272.5 45 273.0 46 259.5 47 225.0 48 212.0 49 193.0 50 144.5 51 116.5 52 98.5 53 80.5 54 60.5 55 46.0 56 30.5 57 20.5 58 21.5 59 20.0 60 17.5 61 12.5 62 11.0 63 9.5 64 5.0 65 4.5 66 5.5 67 4.5 68 2.5 69 2.5 70 3.0 71 1.0 72 0.5 73 1.0 74 1.0 75 1.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.075 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.08750000000000001 52-53 0.11249999999999999 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.125 90-91 0.125 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87468671679198 99.625 2 0.07518796992481204 0.15 3 0.0 0.0 4 0.02506265664160401 0.1 5 0.02506265664160401 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTA 5 0.125 TruSeq Adapter, Index 27 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.15 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.16249999999999998 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.175 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.175 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.175 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276469 spots for SRR3207822.sra Written 1276469 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra Read 1276465 spots for SRR3207822.sra Written 1276465 spots for SRR3207822.sra SRR ids: ['SRR3207822.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u61c5x7h SRR3207822.sra spots: 25529304 blocks: [[1, 1276465], [1276466, 2552930], [2552931, 3829395], [3829396, 5105860], [5105861, 6382325], [6382326, 7658790], [7658791, 8935255], [8935256, 10211720], [10211721, 11488185], [11488186, 12764650], [12764651, 14041115], [14041116, 15317580], [15317581, 16594045], [16594046, 17870510], [17870511, 19146975], [19146976, 20423440], [20423441, 21699905], [21699906, 22976370], [22976371, 24252835], [24252836, 25529304]] SRR3207822 file size 6632941 SRR3207822 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207822 SRR3207822_1.fastq Input file: SRR3207822_1.fastq trimmed: SRR3207822-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 01:05:44 2025 >> started Tue Feb 11 01:05:58 2025 >> done (13.366s) 25529304 reads processed; of these: 5194 ( 0.02%) short reads filtered out after trimming by size control 36235 ( 0.14%) empty reads filtered out after trimming by size control 25487875 (99.84%) reads available; of these: 2477920 ( 9.72%) trimmed reads available after processing 23009955 (90.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 905 0.00% 19 1157 0.00% 20 1442 0.01% 21 1808 0.01% 22 2493 0.01% 23 3363 0.01% 24 4342 0.02% 25 5662 0.02% 26 5725 0.02% 27 5508 0.02% 28 5686 0.02% 29 5573 0.02% 30 5578 0.02% 31 5762 0.02% 32 5766 0.02% 33 5977 0.02% 34 6480 0.03% 35 6727 0.03% 36 7087 0.03% 37 7645 0.03% 38 7964 0.03% 39 8336 0.03% 40 8686 0.03% 41 8990 0.04% 42 9698 0.04% 43 10243 0.04% 44 10779 0.04% 45 11132 0.04% 46 11277 0.04% 47 12159 0.05% 48 12551 0.05% 49 13539 0.05% 50 14325 0.06% 51 14863 0.06% 52 15130 0.06% 53 16276 0.06% 54 17756 0.07% 55 18352 0.07% 56 19031 0.07% 57 19386 0.08% 58 20284 0.08% 59 19533 0.08% 60 20216 0.08% 61 20395 0.08% 62 20421 0.08% 63 20659 0.08% 64 21073 0.08% 65 21019 0.08% 66 21675 0.09% 67 22288 0.09% 68 22486 0.09% 69 22454 0.09% 70 23246 0.09% 71 24429 0.10% 72 24405 0.10% 73 25036 0.10% 74 25307 0.10% 75 24935 0.10% 76 18235 0.07% 77 20997 0.08% 78 23761 0.09% 79 25796 0.10% 80 28217 0.11% 81 30571 0.12% 82 33161 0.13% 83 35935 0.14% 84 38022 0.15% 85 41659 0.16% 86 44965 0.18% 87 48045 0.19% 88 50497 0.20% 89 54278 0.21% 90 61089 0.24% 91 67802 0.27% 92 76117 0.30% 93 85979 0.34% 94 101312 0.40% 95 120899 0.47% 96 143716 0.56% 97 171570 0.67% 98 203313 0.80% 99 196964 0.77% 100 23009955 90.28% 25487875 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=7.88 fanout-score-rank=17 prefix-density=0.05 prefix-fanout=7.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=19 fanout-score=276.02 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=27.6 sequence=TTCTTCTTCTTT Started job on | Feb 11 01:06:20 Started mapping on | Feb 11 01:06:21 Finished on | Feb 11 01:07:14 Mapping speed, Million of reads per hour | 1731.25 Number of input reads | 25487875 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 22276914 Uniquely mapped reads % | 87.40% Average mapped length | 97.99 Number of splices: Total | 5989682 Number of splices: Annotated (sjdb) | 5855405 Number of splices: GT/AG | 5895408 Number of splices: GC/AG | 76552 Number of splices: AT/AC | 6163 Number of splices: Non-canonical | 11559 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 1.94 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 562010 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 128662 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.88% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2648951 2648951 2648951 N_multimapping 562010 562010 562010 N_noFeature 1210447 11622014 11687976 N_ambiguous 258489 40361 41222 UnstrandedReadsAssigned:20807978 PositiveStrandReadsAssigned:10614539 NegativeStrandReadsAssigned:10547716 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207822 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207822-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,487,875 reads, 21,362,180 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,241 rounds 52401 SRR3207822.ke.tsv 34699 SRR3207822.se.tsv 87100 total ==> SRR3207822.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1170 40.6642 Potri.005G024800.1.v4.1 1035 936 385 27.4338 Potri.004G059700.1.v4.1 961 862 14 1.08323 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 386.856 9.07238 Potri.016G087400.1.v4.1 270 171 679 264.835 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 59.6418 2.37628 Potri.012G127500.1.v4.1 977 878 2184 165.905 ==> SRR3207822.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1344 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 352 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 39 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207822 completed mapping pipeline successfully