Starting /dee2/code/volunteer_pipeline.sh SRR3207823 current disk space = 3056961208320 free memory = 1372600064 SRR3207823 SRAfilesize 4898c66b8f24a24a54ecd59625747477 SRR3207823.sra SRR3207823.sra file validated SRR3207823 is single end SRR3207823 is conventional basespace SRR3207823 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207823_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.19975 34.0 33.0 34.0 31.0 34.0 2 32.94625 34.0 34.0 34.0 31.0 34.0 3 32.97875 34.0 33.0 34.0 31.0 34.0 4 36.4405 37.0 37.0 37.0 35.0 37.0 5 36.60425 37.0 37.0 37.0 35.0 37.0 6 36.70875 37.0 37.0 37.0 36.0 37.0 7 36.68025 37.0 37.0 37.0 36.0 37.0 8 36.6785 37.0 37.0 37.0 36.0 37.0 9 38.63075 39.0 39.0 39.0 38.0 39.0 10-11 38.64025 39.0 39.0 39.0 38.0 39.0 12-13 38.608374999999995 39.0 39.0 39.0 38.0 39.0 14-15 40.241249999999994 41.0 40.0 41.0 38.5 41.0 16-17 40.263 41.0 40.0 41.0 39.0 41.0 18-19 40.276875000000004 41.0 40.0 41.0 39.0 41.0 20-21 40.199875000000006 41.0 40.0 41.0 39.0 41.0 22-23 40.106125000000006 41.0 40.0 41.0 38.0 41.0 24-25 40.08325000000001 41.0 40.0 41.0 38.0 41.0 26-27 39.959500000000006 41.0 40.0 41.0 38.0 41.0 28-29 39.83 41.0 40.0 41.0 38.0 41.0 30-31 39.761625 41.0 40.0 41.0 38.0 41.0 32-33 39.72625 41.0 40.0 41.0 38.0 41.0 34-35 39.415375 41.0 40.0 41.0 37.0 41.0 36-37 39.223375000000004 41.0 39.0 41.0 36.5 41.0 38-39 39.277249999999995 41.0 39.5 41.0 36.5 41.0 40-41 39.295375 41.0 39.0 41.0 37.0 41.0 42-43 39.468875 41.0 40.0 41.0 37.0 41.0 44-45 39.4885 41.0 40.0 41.0 37.0 41.0 46-47 39.412125 41.0 40.0 41.0 37.0 41.0 48-49 39.324875000000006 41.0 40.0 41.0 37.0 41.0 50-51 39.21625 41.0 40.0 41.0 36.0 41.0 52-53 39.029375 41.0 39.0 41.0 36.0 41.0 54-55 38.7685 40.0 39.0 41.0 35.0 41.0 56-57 38.5595 40.0 39.0 41.0 35.0 41.0 58-59 38.365625 40.0 38.0 41.0 34.5 41.0 60-61 38.216625 40.0 38.0 41.0 34.5 41.0 62-63 37.967749999999995 40.0 37.0 41.0 34.0 41.0 64-65 37.602374999999995 39.5 36.5 41.0 33.5 41.0 66-67 37.134375000000006 39.0 36.0 41.0 33.0 41.0 68-69 36.69425 38.5 35.5 40.5 32.0 41.0 70-71 36.303625 37.5 35.0 39.5 32.0 41.0 72-73 35.806 37.0 35.0 39.0 32.0 41.0 74-75 35.27275 36.5 35.0 39.0 31.0 40.5 76-77 34.314625 35.5 34.0 37.0 30.5 39.0 78-79 34.530375 35.5 34.5 37.0 31.0 39.0 80-81 34.135875 35.0 34.0 37.0 31.0 38.5 82-83 33.72525 35.0 34.0 36.0 30.5 37.0 84-85 33.352374999999995 35.0 34.0 36.0 30.0 37.0 86-87 33.136 35.0 34.0 35.5 30.0 36.5 88-89 32.82875 35.0 34.0 35.0 29.0 36.0 90-91 32.615625 35.0 34.0 35.0 29.0 36.0 92-93 32.362875 35.0 34.0 35.0 29.0 36.0 94-95 32.142375 35.0 33.5 35.0 28.0 35.0 96-97 31.873874999999998 35.0 33.0 35.0 27.0 35.0 98-99 31.809625 35.0 33.0 35.0 27.0 35.0 100 31.625 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 2.0 11 1.0 12 5.0 13 6.0 14 1.0 15 4.0 16 4.0 17 6.0 18 7.0 19 4.0 20 13.0 21 5.0 22 5.0 23 15.0 24 13.0 25 11.0 26 16.0 27 10.0 28 19.0 29 27.0 30 22.0 31 36.0 32 42.0 33 63.0 34 106.0 35 146.0 36 319.0 37 886.0 38 1758.0 39 444.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.987080103359176 14.496124031007751 18.449612403100776 42.0671834625323 2 19.675 24.15 35.949999999999996 20.225 3 21.099999999999998 27.450000000000003 27.125 24.325 4 23.190583521162033 33.558727773603806 20.63611319809667 22.61457550713749 5 23.375 36.175000000000004 22.575 17.875 6 19.1 37.55 23.724999999999998 19.625 7 16.675 16.825000000000003 44.05 22.45 8 19.975 23.200000000000003 28.025 28.799999999999997 9 19.825 22.875 32.475 24.825 10-11 22.675 32.887499999999996 22.400000000000002 22.037499999999998 12-13 20.3 26.150000000000002 30.275000000000002 23.275000000000002 14-15 20.549999999999997 28.95 28.262500000000003 22.237499999999997 16-17 21.775 27.775 28.375 22.075 18-19 21.512500000000003 28.599999999999998 27.700000000000003 22.1875 20-21 21.875 27.55 28.050000000000004 22.525000000000002 22-23 21.1625 27.9125 28.475 22.45 24-25 21.6125 29.062500000000004 26.7125 22.6125 26-27 21.375 28.499999999999996 27.712500000000002 22.412499999999998 28-29 21.5375 28.8875 28.3125 21.2625 30-31 21.6125 28.487499999999997 28.125 21.775 32-33 21.875 28.449999999999996 27.3875 22.287499999999998 34-35 21.8125 27.9375 27.987499999999997 22.2625 36-37 21.099999999999998 27.9125 28.749999999999996 22.237499999999997 38-39 22.05 27.9125 28.212500000000002 21.825 40-41 21.475 27.575 28.487499999999997 22.4625 42-43 21.125 28.625 27.8125 22.4375 44-45 21.0375 27.725 28.475 22.7625 46-47 21.525 29.062500000000004 27.8125 21.6 48-49 21.975 28.5625 27.462500000000002 22.0 50-51 21.2875 28.725 27.4125 22.575 52-53 21.7 28.812500000000004 27.150000000000002 22.3375 54-55 21.525 28.000000000000004 27.900000000000002 22.575 56-57 20.9875 28.299999999999997 28.275 22.4375 58-59 21.875 27.075 28.287499999999998 22.7625 60-61 21.462500000000002 28.8625 27.425 22.25 62-63 22.175 28.762500000000003 27.6375 21.425 64-65 21.65 28.012500000000003 27.800000000000004 22.537499999999998 66-67 20.674999999999997 28.775000000000002 28.4125 22.1375 68-69 22.225 27.975 27.6 22.2 70-71 21.987499999999997 28.225 27.175 22.6125 72-73 21.725 28.262500000000003 28.225 21.7875 74-75 21.7375 29.025000000000002 28.1125 21.125 76-77 21.212500000000002 29.075 27.725 21.987499999999997 78-79 21.0375 28.3125 28.512500000000003 22.1375 80-81 22.162499999999998 28.799999999999997 26.687499999999996 22.35 82-83 22.0875 28.325 27.55 22.037499999999998 84-85 22.225 28.025 27.775 21.975 86-87 21.8 28.4375 28.0625 21.7 88-89 22.037499999999998 28.787499999999998 27.462500000000002 21.712500000000002 90-91 21.4125 28.6625 27.3 22.625 92-93 21.8875 27.975 28.125 22.0125 94-95 22.2125 28.4125 27.1625 22.2125 96-97 21.825 28.9125 27.8625 21.4 98-99 22.4875 28.4 28.175 20.9375 100 22.15 28.325 27.625 21.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 1.0 25 3.0 26 5.5 27 6.5 28 9.0 29 12.0 30 15.0 31 24.0 32 41.0 33 50.0 34 55.5 35 73.0 36 110.0 37 137.0 38 144.0 39 166.0 40 196.0 41 221.5 42 248.0 43 255.5 44 272.5 45 270.5 46 239.5 47 240.5 48 231.0 49 196.0 50 161.5 51 134.0 52 105.0 53 84.5 54 66.0 55 47.5 56 38.0 57 29.5 58 20.0 59 12.0 60 8.5 61 10.5 62 11.5 63 8.5 64 6.5 65 7.0 66 4.0 67 4.0 68 5.0 69 1.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.5 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.25 2 0.0 3 0.0 4 0.17500000000000002 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833721 spots for SRR3207823.sra Written 1833721 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra Read 1833708 spots for SRR3207823.sra Written 1833708 spots for SRR3207823.sra SRR ids: ['SRR3207823.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cmtxqern SRR3207823.sra spots: 36674173 blocks: [[1, 1833708], [1833709, 3667416], [3667417, 5501124], [5501125, 7334832], [7334833, 9168540], [9168541, 11002248], [11002249, 12835956], [12835957, 14669664], [14669665, 16503372], [16503373, 18337080], [18337081, 20170788], [20170789, 22004496], [22004497, 23838204], [23838205, 25671912], [25671913, 27505620], [27505621, 29339328], [29339329, 31173036], [31173037, 33006744], [33006745, 34840452], [34840453, 36674173]] SRR3207823 file size 9533800 SRR3207823 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207823 SRR3207823_1.fastq Input file: SRR3207823_1.fastq trimmed: SRR3207823-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 02:24:31 2025 >> started Tue Feb 11 02:36:47 2025 >> done (735.913s) 36674173 reads processed; of these: 5937 ( 0.02%) short reads filtered out after trimming by size control 27299 ( 0.07%) empty reads filtered out after trimming by size control 36640937 (99.91%) reads available; of these: 1935742 ( 5.28%) trimmed reads available after processing 34705195 (94.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1062 0.00% 19 1555 0.00% 20 2471 0.01% 21 2419 0.01% 22 3536 0.01% 23 5104 0.01% 24 6679 0.02% 25 8931 0.02% 26 10744 0.03% 27 11755 0.03% 28 10360 0.03% 29 10121 0.03% 30 10250 0.03% 31 10195 0.03% 32 10553 0.03% 33 10352 0.03% 34 10650 0.03% 35 10795 0.03% 36 11123 0.03% 37 11246 0.03% 38 11212 0.03% 39 11350 0.03% 40 11130 0.03% 41 11499 0.03% 42 11586 0.03% 43 11800 0.03% 44 12338 0.03% 45 12856 0.04% 46 13344 0.04% 47 13385 0.04% 48 14114 0.04% 49 14317 0.04% 50 14293 0.04% 51 14990 0.04% 52 15102 0.04% 53 15407 0.04% 54 15775 0.04% 55 16212 0.04% 56 16561 0.05% 57 15783 0.04% 58 15877 0.04% 59 16267 0.04% 60 17164 0.05% 61 16855 0.05% 62 17181 0.05% 63 16916 0.05% 64 17185 0.05% 65 17627 0.05% 66 18076 0.05% 67 18408 0.05% 68 18482 0.05% 69 18862 0.05% 70 19659 0.05% 71 19955 0.05% 72 20898 0.06% 73 20687 0.06% 74 20778 0.06% 75 21114 0.06% 76 15590 0.04% 77 17423 0.05% 78 20024 0.05% 79 20862 0.06% 80 21938 0.06% 81 22580 0.06% 82 23863 0.07% 83 25738 0.07% 84 26434 0.07% 85 27635 0.08% 86 29055 0.08% 87 31395 0.09% 88 32772 0.09% 89 35906 0.10% 90 39230 0.11% 91 43557 0.12% 92 50981 0.14% 93 57643 0.16% 94 65676 0.18% 95 75883 0.21% 96 90287 0.25% 97 111623 0.30% 98 129943 0.35% 99 154758 0.42% 100 34705195 94.72% 36640937 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=14.25 fanout-score-rank=15 prefix-density=0.12 prefix-fanout=14.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=13 fanout-score=278.49 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=28.7 sequence=TTCTTCTTCTTT Started job on | Feb 11 02:43:14 Started mapping on | Feb 11 02:43:27 Finished on | Feb 11 03:19:24 Mapping speed, Million of reads per hour | 61.15 Number of input reads | 36640937 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 35288772 Uniquely mapped reads % | 96.31% Average mapped length | 98.59 Number of splices: Total | 9642971 Number of splices: Annotated (sjdb) | 9457399 Number of splices: GT/AG | 9494681 Number of splices: GC/AG | 121135 Number of splices: AT/AC | 10239 Number of splices: Non-canonical | 16916 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 852376 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 301220 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 499789 499789 499789 N_multimapping 852376 852376 852376 N_noFeature 1636762 18278731 18377763 N_ambiguous 396317 63581 64242 UnstrandedReadsAssigned:33255693 PositiveStrandReadsAssigned:16946460 NegativeStrandReadsAssigned:16846767 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207823 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207823-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,640,937 reads, 34,180,410 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,261 rounds 52401 SRR3207823.ke.tsv 34699 SRR3207823.se.tsv 87100 total ==> SRR3207823.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2238.6 48.2589 Potri.005G024800.1.v4.1 1035 936 568 25.1043 Potri.004G059700.1.v4.1 961 862 69 3.31144 Potri.007G009000.2.v4.1 1416 1317 1 0.0314116 Potri.003G141000.2.v4.1 2943 2844 523.576 7.61598 Potri.016G087400.1.v4.1 270 171 1320 319.34 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 125.541 3.10245 Potri.012G127500.1.v4.1 977 878 7339 345.794 ==> SRR3207823.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4490 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 772 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 79 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207823 completed mapping pipeline successfully