Starting /dee2/code/volunteer_pipeline.sh SRR3207824 current disk space = 3057007427584 free memory = 1258933380 SRR3207824 SRAfilesize 577e513c841e2a340e869a6786f7b29a SRR3207824.sra SRR3207824.sra file validated SRR3207824 is single end SRR3207824 is conventional basespace SRR3207824 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207824_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.58475 34.0 33.0 34.0 31.0 34.0 2 33.19125 34.0 34.0 34.0 31.0 34.0 3 33.09775 34.0 33.0 34.0 31.0 34.0 4 36.47725 37.0 37.0 37.0 35.0 37.0 5 36.5985 37.0 37.0 37.0 35.0 37.0 6 36.71075 37.0 37.0 37.0 36.0 37.0 7 36.706 37.0 37.0 37.0 36.0 37.0 8 36.717 37.0 37.0 37.0 37.0 37.0 9 38.6765 39.0 39.0 39.0 38.0 39.0 10-11 38.663124999999994 39.0 39.0 39.0 38.0 39.0 12-13 38.6185 39.0 39.0 39.0 38.0 39.0 14-15 40.247125 41.0 40.5 41.0 39.0 41.0 16-17 40.313874999999996 41.0 40.5 41.0 39.0 41.0 18-19 40.311125 41.0 40.0 41.0 39.0 41.0 20-21 40.269375 41.0 40.0 41.0 39.0 41.0 22-23 40.070499999999996 41.0 40.0 41.0 38.5 41.0 24-25 40.046 41.0 40.0 41.0 38.0 41.0 26-27 39.994125 41.0 40.0 41.0 38.0 41.0 28-29 39.872125 41.0 40.0 41.0 38.0 41.0 30-31 39.782250000000005 41.0 40.0 41.0 38.0 41.0 32-33 39.7195 41.0 40.0 41.0 38.0 41.0 34-35 39.426500000000004 41.0 40.0 41.0 37.5 41.0 36-37 39.320125000000004 41.0 40.0 41.0 37.0 41.0 38-39 39.319 41.0 39.5 41.0 37.0 41.0 40-41 39.29525 41.0 40.0 41.0 37.0 41.0 42-43 39.452124999999995 41.0 40.0 41.0 37.0 41.0 44-45 39.51775 41.0 40.0 41.0 38.0 41.0 46-47 39.420249999999996 41.0 40.0 41.0 37.0 41.0 48-49 39.379625000000004 41.0 40.0 41.0 37.0 41.0 50-51 39.243625 41.0 39.5 41.0 36.0 41.0 52-53 39.110375 41.0 39.0 41.0 36.0 41.0 54-55 38.92425 41.0 39.0 41.0 35.5 41.0 56-57 38.7535 40.0 39.0 41.0 35.0 41.0 58-59 38.458749999999995 40.0 38.0 41.0 35.0 41.0 60-61 38.294 40.0 38.0 41.0 35.0 41.0 62-63 37.994875 40.0 37.0 41.0 34.0 41.0 64-65 37.569 39.0 36.5 41.0 34.0 41.0 66-67 37.144625 39.0 36.0 41.0 33.0 41.0 68-69 36.74125 38.5 35.0 40.5 33.0 41.0 70-71 36.278375 37.0 35.0 39.5 33.0 41.0 72-73 35.84075 37.0 35.0 39.0 32.5 41.0 74-75 35.270375 36.5 35.0 39.0 31.5 40.5 76-77 34.354375000000005 35.0 34.0 37.0 30.5 39.0 78-79 34.461625 35.5 35.0 37.0 31.0 39.0 80-81 34.076875 35.0 34.5 37.0 31.0 38.5 82-83 33.795500000000004 35.0 34.0 36.0 31.0 37.0 84-85 33.33475 35.0 34.0 36.0 30.0 37.0 86-87 33.111875 35.0 34.0 35.5 29.5 36.5 88-89 32.849875 35.0 34.0 35.0 29.0 36.0 90-91 32.72375 35.0 34.0 35.0 29.0 36.0 92-93 32.512625 35.0 34.0 35.0 29.0 36.0 94-95 32.190625 35.0 34.0 35.0 28.0 35.0 96-97 32.021375 35.0 33.0 35.0 27.5 35.0 98-99 31.832625 35.0 33.0 35.0 26.5 35.0 100 31.625 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 2.0 10 4.0 11 4.0 12 6.0 13 3.0 14 1.0 15 5.0 16 2.0 17 7.0 18 1.0 19 7.0 20 2.0 21 15.0 22 6.0 23 14.0 24 11.0 25 12.0 26 10.0 27 18.0 28 18.0 29 17.0 30 32.0 31 34.0 32 39.0 33 53.0 34 83.0 35 151.0 36 317.0 37 891.0 38 1783.0 39 449.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.78305257784584 15.594691168963756 17.355793772332824 42.266462480857584 2 21.125 23.825 35.275 19.775000000000002 3 21.2 27.975 27.6 23.225 4 23.15973960941412 33.09964947421132 20.305458187280923 23.43515272909364 5 24.625 35.949999999999996 21.6 17.825 6 18.425 38.65 23.275000000000002 19.650000000000002 7 16.55 17.5 44.375 21.575 8 20.275000000000002 23.150000000000002 28.275 28.299999999999997 9 19.625 24.175 31.05 25.15 10-11 23.200000000000003 32.6 22.3125 21.8875 12-13 19.9625 26.637499999999996 30.55 22.85 14-15 21.0 28.1625 28.799999999999997 22.037499999999998 16-17 20.549999999999997 28.1375 27.9375 23.375 18-19 21.6625 28.7375 27.712500000000002 21.8875 20-21 21.2875 28.999999999999996 27.325 22.3875 22-23 20.8625 28.499999999999996 27.487499999999997 23.150000000000002 24-25 21.637500000000003 28.425 27.987499999999997 21.95 26-27 21.9625 27.950000000000003 28.799999999999997 21.2875 28-29 21.6 28.5625 26.75 23.0875 30-31 20.9375 28.6625 28.125 22.275 32-33 20.5625 29.362500000000004 28.4125 21.6625 34-35 21.075 28.4375 28.125 22.3625 36-37 20.962500000000002 28.625 28.4375 21.975 38-39 21.525 28.825 27.9125 21.7375 40-41 21.1625 29.525000000000002 27.0625 22.25 42-43 21.337500000000002 28.1625 28.050000000000004 22.45 44-45 21.512500000000003 28.512500000000003 27.762500000000003 22.2125 46-47 20.575 28.799999999999997 27.9375 22.6875 48-49 22.25 27.287499999999998 27.2625 23.200000000000003 50-51 21.975 28.025 28.025 21.975 52-53 20.9125 28.125 28.1875 22.775000000000002 54-55 21.4125 27.6375 28.0625 22.8875 56-57 22.112499999999997 28.775000000000002 27.6125 21.5 58-59 22.2 28.4 27.675 21.725 60-61 21.3875 28.212500000000002 28.237499999999997 22.162499999999998 62-63 22.0125 27.4125 28.525 22.05 64-65 22.237499999999997 28.475 27.6875 21.6 66-67 21.4 28.012500000000003 27.8375 22.75 68-69 22.5125 28.487499999999997 27.525 21.475 70-71 21.987499999999997 28.125 28.1625 21.725 72-73 21.099999999999998 28.6375 28.050000000000004 22.2125 74-75 21.637500000000003 28.575 27.5875 22.2 76-77 21.2625 28.3875 27.975 22.375 78-79 21.7 28.5625 28.1625 21.575 80-81 21.8875 27.212500000000002 27.8875 23.0125 82-83 22.3 26.775 27.925 23.0 84-85 22.0125 27.800000000000004 28.1875 22.0 86-87 21.712500000000002 27.6625 29.175 21.45 88-89 22.7375 28.4375 27.474999999999998 21.349999999999998 90-91 22.1 27.187499999999996 28.6375 22.075 92-93 21.9 28.525 27.6 21.975 94-95 21.224999999999998 28.65 28.5875 21.5375 96-97 22.075 28.249999999999996 28.125 21.55 98-99 22.375 28.8875 27.275 21.462500000000002 100 22.0 27.125 28.299999999999997 22.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.5 25 4.0 26 8.0 27 7.0 28 5.5 29 15.5 30 24.0 31 30.0 32 38.5 33 50.0 34 59.0 35 79.5 36 104.0 37 120.0 38 139.5 39 170.0 40 193.0 41 219.5 42 242.0 43 250.5 44 258.5 45 258.5 46 264.5 47 255.5 48 220.5 49 191.0 50 167.5 51 138.0 52 105.5 53 82.5 54 66.0 55 45.0 56 41.5 57 34.5 58 20.0 59 14.0 60 13.0 61 13.0 62 9.0 63 5.5 64 4.0 65 5.0 66 5.5 67 3.0 68 2.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 2.5 80 2.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.15 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra Read 955174 spots for SRR3207824.sra Written 955174 spots for SRR3207824.sra Read 955173 spots for SRR3207824.sra Written 955173 spots for SRR3207824.sra SRR ids: ['SRR3207824.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wlwzu7kp SRR3207824.sra spots: 19103461 blocks: [[1, 955173], [955174, 1910346], [1910347, 2865519], [2865520, 3820692], [3820693, 4775865], [4775866, 5731038], [5731039, 6686211], [6686212, 7641384], [7641385, 8596557], [8596558, 9551730], [9551731, 10506903], [10506904, 11462076], [11462077, 12417249], [12417250, 13372422], [13372423, 14327595], [14327596, 15282768], [15282769, 16237941], [16237942, 17193114], [17193115, 18148287], [18148288, 19103461]] SRR3207824 file size 4960939 SRR3207824 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207824 SRR3207824_1.fastq Input file: SRR3207824_1.fastq trimmed: SRR3207824-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 01:28:41 2025 >> started Tue Feb 11 01:28:52 2025 >> done (10.162s) 19103461 reads processed; of these: 3644 ( 0.02%) short reads filtered out after trimming by size control 20338 ( 0.11%) empty reads filtered out after trimming by size control 19079479 (99.87%) reads available; of these: 999725 ( 5.24%) trimmed reads available after processing 18079754 (94.76%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 620 0.00% 19 855 0.00% 20 1063 0.01% 21 1360 0.01% 22 1825 0.01% 23 2667 0.01% 24 3468 0.02% 25 4786 0.03% 26 5537 0.03% 27 6238 0.03% 28 5602 0.03% 29 5364 0.03% 30 5263 0.03% 31 5180 0.03% 32 5501 0.03% 33 5369 0.03% 34 5489 0.03% 35 5671 0.03% 36 5888 0.03% 37 5828 0.03% 38 5815 0.03% 39 5985 0.03% 40 5913 0.03% 41 6026 0.03% 42 5985 0.03% 43 6135 0.03% 44 6567 0.03% 45 6745 0.04% 46 7153 0.04% 47 7077 0.04% 48 7247 0.04% 49 7573 0.04% 50 7539 0.04% 51 7901 0.04% 52 7790 0.04% 53 8093 0.04% 54 8359 0.04% 55 8552 0.04% 56 8545 0.04% 57 8234 0.04% 58 8408 0.04% 59 8357 0.04% 60 8867 0.05% 61 8792 0.05% 62 8916 0.05% 63 8745 0.05% 64 9189 0.05% 65 9396 0.05% 66 9357 0.05% 67 9720 0.05% 68 9811 0.05% 69 9797 0.05% 70 10204 0.05% 71 10530 0.06% 72 10684 0.06% 73 10511 0.06% 74 10629 0.06% 75 10805 0.06% 76 8061 0.04% 77 8962 0.05% 78 10414 0.05% 79 10765 0.06% 80 11295 0.06% 81 11458 0.06% 82 12303 0.06% 83 13442 0.07% 84 13730 0.07% 85 14484 0.08% 86 15034 0.08% 87 16468 0.09% 88 16698 0.09% 89 18607 0.10% 90 19967 0.10% 91 22619 0.12% 92 26095 0.14% 93 29576 0.16% 94 33158 0.17% 95 38848 0.20% 96 46570 0.24% 97 57154 0.30% 98 65839 0.35% 99 78652 0.41% 100 18079754 94.76% 19079479 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=20.94 fanout-score-rank=17 prefix-density=0.15 prefix-fanout=19.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=9 fanout-score=255.39 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=27.1 sequence=TTCTTCTTCTTT Started job on | Feb 11 01:53:56 Started mapping on | Feb 11 01:54:07 Finished on | Feb 11 03:10:08 Mapping speed, Million of reads per hour | 15.06 Number of input reads | 19079479 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 18395453 Uniquely mapped reads % | 96.41% Average mapped length | 98.58 Number of splices: Total | 4940425 Number of splices: Annotated (sjdb) | 4843671 Number of splices: GT/AG | 4864194 Number of splices: GC/AG | 62138 Number of splices: AT/AC | 5298 Number of splices: Non-canonical | 8795 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 456193 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 110559 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 227833 227833 227833 N_multimapping 456193 456193 456193 N_noFeature 896273 9565256 9595891 N_ambiguous 198882 34261 34371 UnstrandedReadsAssigned:17300298 PositiveStrandReadsAssigned:8795936 NegativeStrandReadsAssigned:8765191 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207824 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207824-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,079,479 reads, 17,734,309 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR3207824.ke.tsv 34699 SRR3207824.se.tsv 87100 total ==> SRR3207824.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2020 84.16 Potri.005G024800.1.v4.1 1035 936 602.045 51.426 Potri.004G059700.1.v4.1 961 862 35 3.24631 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 358.648 10.0825 Potri.016G087400.1.v4.1 270 171 620.45 290.095 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 72 3.43879 Potri.012G127500.1.v4.1 977 878 5039 458.859 ==> SRR3207824.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1838 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 359 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207824 completed mapping pipeline successfully