Starting /dee2/code/volunteer_pipeline.sh SRR3207825 current disk space = 3056974487552 free memory = 1578109160 SRR3207825 SRAfilesize 8c4a554d8daf2247204581363f7d90db SRR3207825.sra SRR3207825.sra file validated SRR3207825 is single end SRR3207825 is conventional basespace SRR3207825 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207825_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55375 34.0 33.0 34.0 31.0 34.0 2 33.15625 34.0 34.0 34.0 31.0 34.0 3 33.074 34.0 33.0 34.0 31.0 34.0 4 36.48225 37.0 37.0 37.0 35.0 37.0 5 36.63175 37.0 37.0 37.0 35.0 37.0 6 36.7185 37.0 37.0 37.0 36.0 37.0 7 36.672 37.0 37.0 37.0 37.0 37.0 8 36.696 37.0 37.0 37.0 37.0 37.0 9 38.66725 39.0 39.0 39.0 39.0 39.0 10-11 38.670125 39.0 39.0 39.0 38.0 39.0 12-13 38.636875 39.0 39.0 39.0 38.0 39.0 14-15 40.227125 41.0 40.5 41.0 38.5 41.0 16-17 40.26625 41.0 40.5 41.0 39.0 41.0 18-19 40.2945 41.0 40.0 41.0 39.0 41.0 20-21 40.20675 41.0 40.0 41.0 39.0 41.0 22-23 40.110375000000005 41.0 40.0 41.0 38.5 41.0 24-25 40.070125 41.0 40.0 41.0 38.0 41.0 26-27 39.972375 41.0 40.0 41.0 38.0 41.0 28-29 39.87925 41.0 40.0 41.0 38.0 41.0 30-31 39.726 41.0 40.0 41.0 38.0 41.0 32-33 39.7195 41.0 40.0 41.0 38.0 41.0 34-35 39.395875000000004 41.0 40.0 41.0 37.5 41.0 36-37 39.270250000000004 41.0 40.0 41.0 36.5 41.0 38-39 39.238 41.0 39.0 41.0 37.0 41.0 40-41 39.206625 41.0 39.0 41.0 37.0 41.0 42-43 39.424375 41.0 40.0 41.0 37.5 41.0 44-45 39.453500000000005 41.0 40.0 41.0 37.5 41.0 46-47 39.355875 41.0 40.0 41.0 37.0 41.0 48-49 39.340125 41.0 40.0 41.0 37.0 41.0 50-51 39.169125 41.0 40.0 41.0 36.0 41.0 52-53 38.965374999999995 41.0 39.0 41.0 36.0 41.0 54-55 38.780625 41.0 39.0 41.0 35.0 41.0 56-57 38.554500000000004 40.0 39.0 41.0 35.0 41.0 58-59 38.276624999999996 40.0 38.0 41.0 34.5 41.0 60-61 38.14 40.0 38.0 41.0 34.5 41.0 62-63 37.832 40.0 37.0 41.0 34.0 41.0 64-65 37.463625 39.5 36.5 41.0 33.5 41.0 66-67 37.05875 39.0 36.0 41.0 33.0 41.0 68-69 36.57575 38.5 35.0 40.5 32.5 41.0 70-71 36.1595 37.5 35.0 40.0 32.0 41.0 72-73 35.635625000000005 37.0 35.0 39.0 31.5 41.0 74-75 35.135374999999996 36.5 35.0 39.0 31.0 40.5 76-77 34.220124999999996 35.5 34.0 37.0 30.5 39.0 78-79 34.343875 35.5 34.5 37.0 31.0 39.0 80-81 34.008125 35.0 34.0 37.0 31.0 39.0 82-83 33.633875 35.0 34.0 36.0 30.5 37.0 84-85 33.28075 35.0 34.0 36.0 30.0 37.0 86-87 32.9725 35.0 34.0 35.5 29.5 36.5 88-89 32.68575 35.0 34.0 35.0 29.0 36.0 90-91 32.437375 35.0 34.0 35.0 28.5 36.0 92-93 32.187125 35.0 34.0 35.0 27.5 36.0 94-95 31.989 35.0 33.5 35.0 26.5 35.0 96-97 31.795875000000002 35.0 33.0 35.0 26.5 35.0 98-99 31.756 35.0 33.0 35.0 26.5 35.0 100 31.5075 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 2.0 11 4.0 12 2.0 13 5.0 14 7.0 15 7.0 16 5.0 17 7.0 18 5.0 19 10.0 20 7.0 21 5.0 22 9.0 23 19.0 24 7.0 25 9.0 26 8.0 27 15.0 28 27.0 29 17.0 30 38.0 31 43.0 32 47.0 33 57.0 34 80.0 35 150.0 36 305.0 37 839.0 38 1753.0 39 505.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.361593462717057 15.67926455566905 17.7732379979571 42.18590398365679 2 19.375 23.150000000000002 36.75 20.724999999999998 3 22.1 26.3 27.474999999999998 24.125 4 23.63090772693173 32.83320830207552 20.455113778444613 23.080770192548137 5 23.375 36.449999999999996 22.25 17.925 6 17.424999999999997 37.175000000000004 24.175 21.224999999999998 7 16.45 17.825 44.7 21.025 8 19.55 23.5 29.5 27.450000000000003 9 19.575 23.275000000000002 30.875000000000004 26.275 10-11 21.712500000000002 33.637499999999996 22.225 22.425 12-13 20.150000000000002 25.474999999999998 31.45 22.925 14-15 20.775 27.975 28.549999999999997 22.7 16-17 21.2875 28.3125 28.825 21.575 18-19 22.175 28.075 27.525 22.225 20-21 21.2 28.3625 27.8625 22.575 22-23 21.875 27.750000000000004 28.625 21.75 24-25 22.3 28.037499999999998 27.125 22.537499999999998 26-27 20.8125 29.725 27.675 21.7875 28-29 22.3125 28.375 27.187499999999996 22.125 30-31 21.325 28.8875 27.9375 21.85 32-33 21.125 28.3125 28.3375 22.225 34-35 20.925 29.862499999999997 27.500000000000004 21.712500000000002 36-37 21.625 28.425 27.474999999999998 22.475 38-39 21.975 28.3625 27.825 21.837500000000002 40-41 21.95 27.775 27.900000000000002 22.375 42-43 21.6 28.962500000000002 27.737499999999997 21.7 44-45 21.6875 28.8375 27.9375 21.5375 46-47 21.337500000000002 28.1 28.375 22.1875 48-49 22.237499999999997 28.287499999999998 27.1625 22.3125 50-51 21.987499999999997 28.7375 27.9375 21.337500000000002 52-53 21.6875 28.5875 27.5875 22.1375 54-55 22.725 28.3625 27.725 21.1875 56-57 21.7 28.9375 28.475 20.8875 58-59 23.1125 28.325 27.5625 21.0 60-61 21.837500000000002 28.15 27.5875 22.425 62-63 21.4375 28.4375 28.125 22.0 64-65 22.112499999999997 28.012500000000003 28.1125 21.762500000000003 66-67 21.762500000000003 28.225 27.987499999999997 22.025 68-69 21.5625 28.012500000000003 28.975 21.45 70-71 22.25 27.425 28.1375 22.1875 72-73 21.8125 28.1625 27.762500000000003 22.2625 74-75 21.349999999999998 28.037499999999998 28.925 21.6875 76-77 22.2 27.787499999999998 28.65 21.3625 78-79 21.4875 27.750000000000004 28.075 22.6875 80-81 22.625 26.887499999999996 29.375 21.1125 82-83 21.4375 28.0625 28.849999999999998 21.65 84-85 22.4625 27.2625 28.000000000000004 22.275 86-87 22.025 27.787499999999998 28.237499999999997 21.95 88-89 22.412499999999998 27.375 27.737499999999997 22.475 90-91 20.674999999999997 29.037499999999998 27.85 22.4375 92-93 21.4375 28.1125 28.375 22.075 94-95 22.6125 27.700000000000003 27.4125 22.275 96-97 21.837500000000002 28.3375 27.675 22.15 98-99 21.762500000000003 29.037499999999998 27.800000000000004 21.4 100 22.650000000000002 25.650000000000002 27.875 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 1.5 23 3.0 24 2.0 25 1.5 26 4.5 27 9.5 28 14.0 29 17.0 30 22.0 31 27.5 32 39.5 33 52.0 34 62.0 35 70.5 36 94.5 37 124.0 38 135.5 39 158.0 40 191.0 41 218.5 42 249.0 43 277.0 44 279.0 45 270.5 46 260.5 47 243.0 48 218.0 49 178.0 50 150.0 51 130.0 52 108.0 53 91.5 54 67.5 55 47.0 56 37.5 57 33.0 58 22.0 59 13.5 60 13.5 61 9.5 62 7.0 63 7.5 64 5.5 65 3.5 66 4.0 67 4.5 68 2.0 69 0.0 70 1.0 71 1.5 72 0.5 73 2.0 74 3.5 75 2.0 76 1.5 77 1.5 78 0.5 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra Read 1103368 spots for SRR3207825.sra Written 1103368 spots for SRR3207825.sra Read 1103365 spots for SRR3207825.sra Written 1103365 spots for SRR3207825.sra SRR ids: ['SRR3207825.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dstnv_3g SRR3207825.sra spots: 22067303 blocks: [[1, 1103365], [1103366, 2206730], [2206731, 3310095], [3310096, 4413460], [4413461, 5516825], [5516826, 6620190], [6620191, 7723555], [7723556, 8826920], [8826921, 9930285], [9930286, 11033650], [11033651, 12137015], [12137016, 13240380], [13240381, 14343745], [14343746, 15447110], [15447111, 16550475], [16550476, 17653840], [17653841, 18757205], [18757206, 19860570], [19860571, 20963935], [20963936, 22067303]] SRR3207825 file size 5732284 SRR3207825 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207825 SRR3207825_1.fastq Input file: SRR3207825_1.fastq trimmed: SRR3207825-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 02:53:33 2025 >> started Tue Feb 11 03:24:55 2025 >> done (1881.727s) 22067303 reads processed; of these: 4621 ( 0.02%) short reads filtered out after trimming by size control 18964 ( 0.09%) empty reads filtered out after trimming by size control 22043718 (99.89%) reads available; of these: 1151632 ( 5.22%) trimmed reads available after processing 20892086 (94.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 814 0.00% 19 1264 0.01% 20 2199 0.01% 21 1577 0.01% 22 2224 0.01% 23 3222 0.01% 24 4085 0.02% 25 5387 0.02% 26 5885 0.03% 27 6160 0.03% 28 5871 0.03% 29 5844 0.03% 30 6112 0.03% 31 6208 0.03% 32 6227 0.03% 33 6174 0.03% 34 6489 0.03% 35 6536 0.03% 36 6721 0.03% 37 7042 0.03% 38 6897 0.03% 39 6732 0.03% 40 6838 0.03% 41 6688 0.03% 42 7010 0.03% 43 6964 0.03% 44 7411 0.03% 45 7849 0.04% 46 8060 0.04% 47 8059 0.04% 48 8277 0.04% 49 8560 0.04% 50 8788 0.04% 51 8892 0.04% 52 9004 0.04% 53 9562 0.04% 54 9712 0.04% 55 9746 0.04% 56 10110 0.05% 57 9462 0.04% 58 9652 0.04% 59 9876 0.04% 60 10264 0.05% 61 10123 0.05% 62 10350 0.05% 63 10026 0.05% 64 10399 0.05% 65 10667 0.05% 66 10621 0.05% 67 11193 0.05% 68 11472 0.05% 69 11453 0.05% 70 11479 0.05% 71 11959 0.05% 72 12388 0.06% 73 12583 0.06% 74 12422 0.06% 75 12743 0.06% 76 9416 0.04% 77 10346 0.05% 78 11831 0.05% 79 12473 0.06% 80 12952 0.06% 81 13485 0.06% 82 14271 0.06% 83 15099 0.07% 84 15976 0.07% 85 16529 0.07% 86 17274 0.08% 87 18676 0.08% 88 19621 0.09% 89 21236 0.10% 90 23418 0.11% 91 25842 0.12% 92 30483 0.14% 93 34028 0.15% 94 38475 0.17% 95 44620 0.20% 96 53272 0.24% 97 65362 0.30% 98 76638 0.35% 99 89977 0.41% 100 20892086 94.78% 22043718 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=39.48 fanout-score-rank=8 prefix-density=0.27 prefix-fanout=29.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=6 fanout-score=245.40 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=27.0 sequence=TTCTTCTTCTTT Started job on | Feb 11 03:27:58 Started mapping on | Feb 11 03:28:05 Finished on | Feb 11 04:00:57 Mapping speed, Million of reads per hour | 40.24 Number of input reads | 22043718 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 21259223 Uniquely mapped reads % | 96.44% Average mapped length | 98.55 Number of splices: Total | 5926902 Number of splices: Annotated (sjdb) | 5812036 Number of splices: GT/AG | 5835735 Number of splices: GC/AG | 74396 Number of splices: AT/AC | 6416 Number of splices: Non-canonical | 10355 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.11 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 505480 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 166837 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 279015 279015 279015 N_multimapping 505480 505480 505480 N_noFeature 1043583 11065784 11089251 N_ambiguous 223104 37436 38214 UnstrandedReadsAssigned:19992536 PositiveStrandReadsAssigned:10156003 NegativeStrandReadsAssigned:10131758 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207825 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207825-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,043,718 reads, 20,509,838 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR3207825.ke.tsv 34699 SRR3207825.se.tsv 87100 total ==> SRR3207825.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1143 41.9215 Potri.005G024800.1.v4.1 1035 936 253 19.0244 Potri.004G059700.1.v4.1 961 862 37 3.02106 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 354.503 8.77316 Potri.016G087400.1.v4.1 270 171 794 326.806 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 82 3.44765 Potri.012G127500.1.v4.1 977 878 4577 366.903 ==> SRR3207825.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 2637 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 471 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207825 completed mapping pipeline successfully