Starting /dee2/code/volunteer_pipeline.sh SRR3207826 current disk space = 3056989958144 free memory = 1507134452 SRR3207826 SRAfilesize cbccd19cf39c2ca8eebd632a4f956c93 SRR3207826.sra SRR3207826.sra file validated SRR3207826 is single end SRR3207826 is conventional basespace SRR3207826 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207826_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4305 34.0 33.0 34.0 31.0 34.0 2 33.09375 34.0 34.0 34.0 31.0 34.0 3 33.1545 34.0 33.0 34.0 31.0 34.0 4 36.55475 37.0 37.0 37.0 35.0 37.0 5 36.63775 37.0 37.0 37.0 35.0 37.0 6 36.72075 37.0 37.0 37.0 37.0 37.0 7 36.7385 37.0 37.0 37.0 37.0 37.0 8 36.7505 37.0 37.0 37.0 37.0 37.0 9 38.698 39.0 39.0 39.0 39.0 39.0 10-11 38.703500000000005 39.0 39.0 39.0 39.0 39.0 12-13 38.666 39.0 39.0 39.0 38.0 39.0 14-15 40.41525 41.0 41.0 41.0 39.0 41.0 16-17 40.321125 41.0 40.5 41.0 39.0 41.0 18-19 40.325625 41.0 40.0 41.0 39.0 41.0 20-21 40.257125 41.0 40.0 41.0 39.0 41.0 22-23 40.089 41.0 40.0 41.0 38.5 41.0 24-25 40.06825 41.0 40.0 41.0 38.0 41.0 26-27 39.9365 41.0 40.0 41.0 38.0 41.0 28-29 39.718125 41.0 40.0 41.0 38.0 41.0 30-31 39.5005 41.0 40.0 41.0 37.5 41.0 32-33 39.47125 41.0 40.0 41.0 38.0 41.0 34-35 39.390875 41.0 40.0 41.0 37.0 41.0 36-37 39.27325 41.0 40.0 41.0 37.0 41.0 38-39 39.16275 41.0 40.0 41.0 36.5 41.0 40-41 38.95375 41.0 39.0 41.0 36.0 41.0 42-43 39.259875 41.0 40.0 41.0 37.0 41.0 44-45 39.20375 41.0 40.0 41.0 36.5 41.0 46-47 39.09525 41.0 40.0 41.0 37.0 41.0 48-49 38.868375 41.0 39.5 41.0 35.0 41.0 50-51 38.673125 41.0 39.0 41.0 35.0 41.0 52-53 38.557500000000005 41.0 39.0 41.0 35.0 41.0 54-55 38.374625 41.0 39.0 41.0 35.0 41.0 56-57 38.11825 40.0 38.0 41.0 34.0 41.0 58-59 37.9005 40.0 38.0 41.0 34.0 41.0 60-61 37.621875 40.0 37.0 41.0 34.0 41.0 62-63 37.400125 40.0 37.0 41.0 33.5 41.0 64-65 36.940125 39.0 36.0 41.0 32.5 41.0 66-67 36.577 39.0 36.0 41.0 32.5 41.0 68-69 35.878375 38.0 35.0 40.5 31.0 41.0 70-71 35.417874999999995 37.0 35.0 39.5 30.5 41.0 72-73 35.007625 37.0 35.0 39.0 30.5 41.0 74-75 34.551625 36.0 35.0 39.0 30.0 40.0 76-77 33.548625 35.0 33.5 37.0 29.0 39.0 78-79 33.60325 35.0 34.0 37.0 29.0 39.0 80-81 33.164500000000004 35.0 34.0 36.5 28.0 38.5 82-83 32.972750000000005 35.0 34.0 36.0 28.5 37.0 84-85 32.581 35.0 34.0 36.0 28.0 37.0 86-87 32.34625 35.0 34.0 35.5 27.0 36.5 88-89 32.052125000000004 35.0 34.0 35.0 26.5 36.0 90-91 31.729125 35.0 34.0 35.0 25.0 36.0 92-93 31.3985 35.0 33.0 35.0 24.5 36.0 94-95 31.21575 35.0 33.0 35.0 23.5 35.5 96-97 30.989874999999998 35.0 33.0 35.0 19.5 35.0 98-99 30.68425 35.0 33.0 35.0 16.0 35.0 100 30.46 35.0 33.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 4.0 9 2.0 10 4.0 11 5.0 12 10.0 13 5.0 14 6.0 15 7.0 16 4.0 17 6.0 18 18.0 19 17.0 20 17.0 21 16.0 22 8.0 23 13.0 24 16.0 25 16.0 26 18.0 27 27.0 28 19.0 29 24.0 30 31.0 31 39.0 32 45.0 33 71.0 34 92.0 35 138.0 36 298.0 37 860.0 38 1691.0 39 470.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.13607188703466 14.993581514762516 19.050064184852374 39.82028241335045 2 21.375 23.974999999999998 33.575 21.075 3 22.3 27.625 27.950000000000003 22.125 4 23.95598899724931 31.657914478619652 20.555138784696176 23.830957739434858 5 24.85 34.675 22.375 18.099999999999998 6 19.1 36.7 24.0 20.200000000000003 7 16.525000000000002 17.5 44.5 21.475 8 19.05 24.175 28.549999999999997 28.225 9 20.424999999999997 23.799999999999997 30.225 25.55 10-11 22.5875 33.4 21.3625 22.650000000000002 12-13 20.75 26.8125 28.875 23.5625 14-15 21.762500000000003 28.125 27.6625 22.45 16-17 22.237499999999997 28.262500000000003 27.55 21.95 18-19 21.5625 28.512500000000003 27.675 22.25 20-21 21.95 28.999999999999996 26.5625 22.4875 22-23 22.275 29.225 27.1125 21.3875 24-25 21.0125 28.65 28.075 22.2625 26-27 21.825 27.3625 28.050000000000004 22.7625 28-29 21.9 28.6875 28.050000000000004 21.3625 30-31 21.95 27.9125 27.775 22.3625 32-33 22.4375 28.175 27.500000000000004 21.8875 34-35 22.8125 28.4 26.937499999999996 21.85 36-37 20.775 29.0875 27.537499999999998 22.6 38-39 21.6875 28.125 28.349999999999998 21.837500000000002 40-41 22.525000000000002 28.625 26.950000000000003 21.9 42-43 21.925 28.499999999999996 26.825 22.75 44-45 22.5625 27.9125 27.55 21.975 46-47 22.075 28.5875 26.775 22.5625 48-49 22.3125 27.3375 28.462500000000002 21.8875 50-51 21.55 27.700000000000003 28.787499999999998 21.9625 52-53 21.725 28.725 27.6 21.95 54-55 21.85 27.775 27.775 22.6 56-57 22.55 29.612500000000004 26.700000000000003 21.1375 58-59 22.8875 27.85 27.900000000000002 21.3625 60-61 21.587500000000002 27.987499999999997 27.525 22.900000000000002 62-63 21.8625 27.487499999999997 28.037499999999998 22.6125 64-65 22.9375 27.9375 27.575 21.55 66-67 22.725 27.9125 27.3125 22.05 68-69 22.35 28.1625 27.3375 22.15 70-71 21.4875 28.15 27.575 22.787499999999998 72-73 22.7125 27.750000000000004 28.037499999999998 21.5 74-75 22.5 28.125 27.825 21.55 76-77 22.0875 27.700000000000003 28.1375 22.075 78-79 21.8875 27.287499999999998 27.250000000000004 23.575 80-81 23.1625 27.700000000000003 27.1125 22.025 82-83 21.85 28.349999999999998 27.825 21.975 84-85 22.400000000000002 28.262500000000003 27.487499999999997 21.85 86-87 21.5375 28.4375 27.025 23.0 88-89 22.9625 27.375 28.6125 21.05 90-91 22.55 28.012500000000003 29.0875 20.349999999999998 92-93 22.412499999999998 28.1375 27.625 21.825 94-95 21.462500000000002 27.650000000000002 28.3375 22.55 96-97 21.6 28.1625 28.299999999999997 21.9375 98-99 22.525000000000002 28.549999999999997 27.05 21.875 100 22.875 28.525 26.325 22.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 4.5 25 7.5 26 9.0 27 7.0 28 11.0 29 15.0 30 21.0 31 32.5 32 40.5 33 47.5 34 59.0 35 75.5 36 95.5 37 121.0 38 139.0 39 157.0 40 194.0 41 222.5 42 231.5 43 245.0 44 263.5 45 261.0 46 245.5 47 225.5 48 208.0 49 183.0 50 151.0 51 136.0 52 125.5 53 103.5 54 69.5 55 43.5 56 33.0 57 30.5 58 24.0 59 21.5 60 15.0 61 8.0 62 9.5 63 11.0 64 13.0 65 11.5 66 7.0 67 6.0 68 4.5 69 2.0 70 3.5 71 6.5 72 5.5 73 3.5 74 3.5 75 4.5 76 4.5 77 2.5 78 0.5 79 0.5 80 1.5 81 1.5 82 2.0 83 2.0 84 1.0 85 0.5 86 0.0 87 0.5 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961934 spots for SRR3207826.sra Written 961934 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra Read 961931 spots for SRR3207826.sra Written 961931 spots for SRR3207826.sra SRR ids: ['SRR3207826.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mex2qo7w SRR3207826.sra spots: 19238623 blocks: [[1, 961931], [961932, 1923862], [1923863, 2885793], [2885794, 3847724], [3847725, 4809655], [4809656, 5771586], [5771587, 6733517], [6733518, 7695448], [7695449, 8657379], [8657380, 9619310], [9619311, 10581241], [10581242, 11543172], [11543173, 12505103], [12505104, 13467034], [13467035, 14428965], [14428966, 15390896], [15390897, 16352827], [16352828, 17314758], [17314759, 18276689], [18276690, 19238623]] SRR3207826 file size 4996152 SRR3207826 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207826 SRR3207826_1.fastq Input file: SRR3207826_1.fastq trimmed: SRR3207826-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 02:32:34 2025 >> started Tue Feb 11 02:45:25 2025 >> done (770.227s) 19238623 reads processed; of these: 4326 ( 0.02%) short reads filtered out after trimming by size control 20117 ( 0.10%) empty reads filtered out after trimming by size control 19214180 (99.87%) reads available; of these: 1367444 ( 7.12%) trimmed reads available after processing 17846736 (92.88%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 760 0.00% 19 1100 0.01% 20 1468 0.01% 21 1897 0.01% 22 3023 0.02% 23 4414 0.02% 24 5488 0.03% 25 6999 0.04% 26 6602 0.03% 27 6259 0.03% 28 6705 0.03% 29 6929 0.04% 30 7834 0.04% 31 7281 0.04% 32 7474 0.04% 33 6928 0.04% 34 7246 0.04% 35 7496 0.04% 36 7733 0.04% 37 7675 0.04% 38 7940 0.04% 39 7790 0.04% 40 7632 0.04% 41 7733 0.04% 42 7575 0.04% 43 8159 0.04% 44 8162 0.04% 45 8590 0.04% 46 9035 0.05% 47 9338 0.05% 48 9626 0.05% 49 9671 0.05% 50 9878 0.05% 51 10160 0.05% 52 9936 0.05% 53 9956 0.05% 54 10251 0.05% 55 9808 0.05% 56 10875 0.06% 57 11935 0.06% 58 11840 0.06% 59 11373 0.06% 60 11496 0.06% 61 11398 0.06% 62 12061 0.06% 63 11874 0.06% 64 11791 0.06% 65 12282 0.06% 66 12499 0.07% 67 13310 0.07% 68 13570 0.07% 69 13880 0.07% 70 13870 0.07% 71 13896 0.07% 72 14950 0.08% 73 14810 0.08% 74 14796 0.08% 75 15633 0.08% 76 11535 0.06% 77 12184 0.06% 78 14957 0.08% 79 15119 0.08% 80 15746 0.08% 81 16307 0.08% 82 17244 0.09% 83 18691 0.10% 84 19366 0.10% 85 21955 0.11% 86 22410 0.12% 87 21444 0.11% 88 22865 0.12% 89 24619 0.13% 90 26586 0.14% 91 30066 0.16% 92 35937 0.19% 93 40170 0.21% 94 45488 0.24% 95 53023 0.28% 96 64723 0.34% 97 83751 0.44% 98 91433 0.48% 99 111135 0.58% 100 17846736 92.88% 19214180 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=34.10 fanout-score-rank=5 prefix-density=0.23 prefix-fanout=26.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=9 fanout-score=187.94 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=24.5 sequence=AAGAAGAAGAAA Started job on | Feb 11 03:00:09 Started mapping on | Feb 11 03:00:14 Finished on | Feb 11 04:37:16 Mapping speed, Million of reads per hour | 11.88 Number of input reads | 19214180 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 17562330 Uniquely mapped reads % | 91.40% Average mapped length | 98.40 Number of splices: Total | 4883510 Number of splices: Annotated (sjdb) | 4783066 Number of splices: GT/AG | 4807505 Number of splices: GC/AG | 62456 Number of splices: AT/AC | 4965 Number of splices: Non-canonical | 8584 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.02% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 438239 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 1125473 % of reads mapped to too many loci | 5.86% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1213611 1213611 1213611 N_multimapping 438239 438239 438239 N_noFeature 866906 9114042 9181912 N_ambiguous 201336 33954 34475 UnstrandedReadsAssigned:16494088 PositiveStrandReadsAssigned:8414334 NegativeStrandReadsAssigned:8345943 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207826 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207826-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,214,180 reads, 17,782,630 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,005 rounds 52401 SRR3207826.ke.tsv 34699 SRR3207826.se.tsv 87100 total ==> SRR3207826.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 842 34.4181 Potri.005G024800.1.v4.1 1035 936 170 14.247 Potri.004G059700.1.v4.1 961 862 39 3.54901 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 281.429 7.76227 Potri.016G087400.1.v4.1 270 171 578 265.144 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 66 3.0927 Potri.012G127500.1.v4.1 977 878 4205 375.683 ==> SRR3207826.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2240 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 415 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 30 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR3207826 completed mapping pipeline successfully