Starting /dee2/code/volunteer_pipeline.sh SRR3207827 current disk space = 3056986472448 free memory = 1578411832 SRR3207827 SRAfilesize 574a0231161dd85997854a59ccb638f9 SRR3207827.sra SRR3207827.sra file validated SRR3207827 is single end SRR3207827 is conventional basespace SRR3207827 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207827_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34775 34.0 33.0 34.0 31.0 34.0 2 33.07625 34.0 34.0 34.0 31.0 34.0 3 33.11975 34.0 33.0 34.0 31.0 34.0 4 36.49775 37.0 37.0 37.0 35.0 37.0 5 36.62425 37.0 37.0 37.0 35.0 37.0 6 36.72175 37.0 37.0 37.0 37.0 37.0 7 36.7625 37.0 37.0 37.0 37.0 37.0 8 36.756 37.0 37.0 37.0 37.0 37.0 9 38.718 39.0 39.0 39.0 38.0 39.0 10-11 38.7285 39.0 39.0 39.0 39.0 39.0 12-13 38.67475 39.0 39.0 39.0 38.0 39.0 14-15 40.448375 41.0 41.0 41.0 39.0 41.0 16-17 40.34125 41.0 41.0 41.0 39.0 41.0 18-19 40.332125000000005 41.0 40.0 41.0 39.0 41.0 20-21 40.26475 41.0 40.0 41.0 39.0 41.0 22-23 40.175375 41.0 40.0 41.0 39.0 41.0 24-25 40.093 41.0 40.0 41.0 38.5 41.0 26-27 39.98925 41.0 40.0 41.0 38.0 41.0 28-29 39.862375 41.0 40.0 41.0 38.0 41.0 30-31 39.68825 41.0 40.0 41.0 38.0 41.0 32-33 39.720375000000004 41.0 40.0 41.0 38.0 41.0 34-35 39.59025 41.0 40.0 41.0 38.0 41.0 36-37 39.52275 41.0 40.0 41.0 37.5 41.0 38-39 39.395625 41.0 40.0 41.0 37.0 41.0 40-41 39.207499999999996 41.0 39.5 41.0 37.0 41.0 42-43 39.464875 41.0 40.0 41.0 37.5 41.0 44-45 39.46825 41.0 40.0 41.0 37.5 41.0 46-47 39.418125 41.0 40.0 41.0 37.0 41.0 48-49 39.267625 41.0 40.0 41.0 37.0 41.0 50-51 39.157875 41.0 40.0 41.0 36.5 41.0 52-53 39.03725 41.0 39.5 41.0 36.0 41.0 54-55 38.79725 41.0 39.0 41.0 35.5 41.0 56-57 38.524249999999995 40.5 39.0 41.0 35.0 41.0 58-59 38.289125 40.0 38.0 41.0 34.5 41.0 60-61 37.9435 40.0 37.5 41.0 34.0 41.0 62-63 37.762625 40.0 37.0 41.0 34.0 41.0 64-65 37.478750000000005 39.5 36.5 41.0 34.0 41.0 66-67 37.02075 39.0 36.0 41.0 33.0 41.0 68-69 36.472625 38.5 35.5 40.5 32.5 41.0 70-71 35.941500000000005 37.0 35.0 39.5 31.0 41.0 72-73 35.6005 37.0 35.0 39.0 31.5 41.0 74-75 35.184125 36.5 35.0 39.0 31.0 40.5 76-77 34.154375 35.0 34.0 37.0 30.0 39.0 78-79 34.1995 35.0 34.0 37.0 31.0 39.0 80-81 33.787375 35.0 34.0 37.0 30.0 38.5 82-83 33.5235 35.0 34.0 36.0 30.0 37.0 84-85 33.161625 35.0 34.0 36.0 29.0 37.0 86-87 32.917 35.0 34.0 35.5 29.0 36.5 88-89 32.54675 35.0 34.0 35.0 29.0 36.0 90-91 32.37225 35.0 34.0 35.0 29.0 36.0 92-93 32.13125 35.0 34.0 35.0 27.0 36.0 94-95 31.9235 35.0 33.0 35.0 27.0 35.5 96-97 31.705375 35.0 33.0 35.0 27.0 35.0 98-99 31.32425 35.0 33.0 35.0 25.0 35.0 100 30.91725 35.0 33.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 1.0 8 0.0 9 4.0 10 3.0 11 2.0 12 4.0 13 5.0 14 5.0 15 7.0 16 7.0 17 7.0 18 8.0 19 6.0 20 8.0 21 7.0 22 15.0 23 10.0 24 5.0 25 17.0 26 15.0 27 20.0 28 13.0 29 21.0 30 26.0 31 38.0 32 45.0 33 57.0 34 96.0 35 136.0 36 322.0 37 882.0 38 1721.0 39 485.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.98045267489712 15.483539094650206 17.644032921810698 39.891975308641975 2 20.25 23.599999999999998 36.3 19.85 3 23.45 26.5 27.6 22.45 4 23.723723723723726 32.032032032032035 21.52152152152152 22.722722722722725 5 23.275000000000002 36.6 22.525000000000002 17.599999999999998 6 18.15 38.35 23.525 19.975 7 16.925 18.65 43.85 20.575 8 20.599999999999998 23.474999999999998 29.2 26.724999999999998 9 19.425 24.474999999999998 31.1 25.0 10-11 22.037499999999998 33.9875 22.525000000000002 21.45 12-13 20.4125 26.375 29.6875 23.525 14-15 20.825 28.875 27.85 22.45 16-17 21.375 27.575 27.825 23.225 18-19 22.325 28.299999999999997 27.1 22.275 20-21 21.3125 28.9375 27.800000000000004 21.95 22-23 21.462500000000002 28.3875 27.712500000000002 22.4375 24-25 21.275 28.275 27.975 22.475 26-27 20.9375 28.000000000000004 29.025000000000002 22.037499999999998 28-29 20.5875 27.8375 28.1125 23.4625 30-31 21.825 27.962500000000002 27.725 22.4875 32-33 21.6 29.15 27.625 21.625 34-35 21.05 29.15 27.375 22.425 36-37 21.462500000000002 29.2 27.762500000000003 21.575 38-39 21.275 29.65 27.200000000000003 21.875 40-41 22.162499999999998 28.762500000000003 27.200000000000003 21.875 42-43 22.3375 28.8625 27.35 21.45 44-45 21.4875 28.6375 28.1875 21.6875 46-47 20.599999999999998 28.287499999999998 28.1375 22.975 48-49 21.975 27.8125 28.237499999999997 21.975 50-51 21.375 28.6625 28.349999999999998 21.6125 52-53 22.237499999999997 28.299999999999997 27.8125 21.65 54-55 21.349999999999998 29.0875 27.487499999999997 22.075 56-57 22.0625 28.6125 27.025 22.3 58-59 21.512500000000003 29.175 28.249999999999996 21.0625 60-61 21.55 28.475 27.8625 22.112499999999997 62-63 21.2625 28.8375 28.575 21.325 64-65 21.7875 28.1625 27.825 22.225 66-67 21.55 28.8375 27.437499999999996 22.175 68-69 21.6875 28.849999999999998 27.9125 21.55 70-71 22.475 28.125 27.275 22.125 72-73 21.224999999999998 28.799999999999997 28.000000000000004 21.975 74-75 22.0625 28.249999999999996 28.449999999999996 21.2375 76-77 21.25 28.7 27.474999999999998 22.575 78-79 21.925 28.4375 28.212500000000002 21.425 80-81 21.637500000000003 28.675 28.050000000000004 21.637500000000003 82-83 21.975 28.675 28.249999999999996 21.099999999999998 84-85 21.7875 28.425 28.712500000000002 21.075 86-87 21.987499999999997 29.075 27.474999999999998 21.462500000000002 88-89 21.512500000000003 28.8625 27.950000000000003 21.675 90-91 22.375 28.3625 27.525 21.7375 92-93 21.6 28.425 28.812500000000004 21.1625 94-95 21.725 29.037499999999998 27.4125 21.825 96-97 22.4875 28.349999999999998 26.887499999999996 22.275 98-99 22.275 28.4 27.825 21.5 100 20.724999999999998 27.55 28.975 22.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 4.5 26 7.5 27 9.5 28 12.0 29 17.0 30 22.0 31 27.5 32 40.5 33 57.0 34 64.5 35 80.0 36 110.5 37 118.0 38 140.5 39 158.5 40 192.5 41 243.0 42 251.5 43 255.0 44 274.0 45 271.5 46 240.0 47 233.5 48 222.5 49 194.5 50 159.0 51 126.0 52 109.5 53 85.5 54 62.5 55 51.0 56 36.0 57 27.0 58 20.5 59 14.0 60 11.5 61 8.5 62 7.0 63 5.5 64 4.0 65 5.0 66 4.5 67 2.0 68 1.0 69 1.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 1.0 88 1.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.8000000000000003 2 0.0 3 0.0 4 0.1 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra Read 1118068 spots for SRR3207827.sra Written 1118068 spots for SRR3207827.sra Read 1118065 spots for SRR3207827.sra Written 1118065 spots for SRR3207827.sra SRR ids: ['SRR3207827.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ken5y2y SRR3207827.sra spots: 22361303 blocks: [[1, 1118065], [1118066, 2236130], [2236131, 3354195], [3354196, 4472260], [4472261, 5590325], [5590326, 6708390], [6708391, 7826455], [7826456, 8944520], [8944521, 10062585], [10062586, 11180650], [11180651, 12298715], [12298716, 13416780], [13416781, 14534845], [14534846, 15652910], [15652911, 16770975], [16770976, 17889040], [17889041, 19007105], [19007106, 20125170], [20125171, 21243235], [21243236, 22361303]] SRR3207827 file size 5808864 SRR3207827 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207827 SRR3207827_1.fastq Input file: SRR3207827_1.fastq trimmed: SRR3207827-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 02:58:54 2025 >> started Tue Feb 11 03:07:45 2025 >> done (531.338s) 22361303 reads processed; of these: 3905 ( 0.02%) short reads filtered out after trimming by size control 25283 ( 0.11%) empty reads filtered out after trimming by size control 22332115 (99.87%) reads available; of these: 1428548 ( 6.40%) trimmed reads available after processing 20903567 (93.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 740 0.00% 19 1029 0.00% 20 1285 0.01% 21 1899 0.01% 22 2697 0.01% 23 3772 0.02% 24 4821 0.02% 25 6205 0.03% 26 6104 0.03% 27 6085 0.03% 28 6469 0.03% 29 6619 0.03% 30 7045 0.03% 31 6820 0.03% 32 7016 0.03% 33 6861 0.03% 34 7123 0.03% 35 7384 0.03% 36 7223 0.03% 37 7608 0.03% 38 7798 0.03% 39 7747 0.03% 40 7466 0.03% 41 7478 0.03% 42 7410 0.03% 43 7867 0.04% 44 8281 0.04% 45 8472 0.04% 46 9058 0.04% 47 9497 0.04% 48 9719 0.04% 49 9687 0.04% 50 9803 0.04% 51 9955 0.04% 52 10011 0.04% 53 10328 0.05% 54 10433 0.05% 55 10482 0.05% 56 11001 0.05% 57 11907 0.05% 58 12060 0.05% 59 11640 0.05% 60 11808 0.05% 61 11659 0.05% 62 12168 0.05% 63 12330 0.06% 64 12237 0.05% 65 12496 0.06% 66 12876 0.06% 67 13598 0.06% 68 14427 0.06% 69 14234 0.06% 70 14343 0.06% 71 14340 0.06% 72 14839 0.07% 73 15184 0.07% 74 15508 0.07% 75 16107 0.07% 76 11843 0.05% 77 12701 0.06% 78 15110 0.07% 79 15736 0.07% 80 16316 0.07% 81 16934 0.08% 82 17831 0.08% 83 19925 0.09% 84 20260 0.09% 85 21988 0.10% 86 23676 0.11% 87 22520 0.10% 88 23995 0.11% 89 26279 0.12% 90 28334 0.13% 91 31985 0.14% 92 37829 0.17% 93 42835 0.19% 94 48872 0.22% 95 57061 0.26% 96 70313 0.31% 97 91273 0.41% 98 99662 0.45% 99 124211 0.56% 100 20903567 93.60% 22332115 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=32.40 fanout-score-rank=16 prefix-density=0.21 prefix-fanout=26.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=228.38 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=24.5 sequence=TTCTTCTTCTTT Started job on | Feb 11 03:21:54 Started mapping on | Feb 11 03:22:00 Finished on | Feb 11 04:13:58 Mapping speed, Million of reads per hour | 25.78 Number of input reads | 22332115 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 21521037 Uniquely mapped reads % | 96.37% Average mapped length | 98.40 Number of splices: Total | 5731880 Number of splices: Annotated (sjdb) | 5611629 Number of splices: GT/AG | 5642099 Number of splices: GC/AG | 72835 Number of splices: AT/AC | 6328 Number of splices: Non-canonical | 10618 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.20 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 513584 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 185135 % of reads mapped to too many loci | 0.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 297494 297494 297494 N_multimapping 513584 513584 513584 N_noFeature 1067833 11174411 11247216 N_ambiguous 249923 41304 41824 UnstrandedReadsAssigned:20203281 PositiveStrandReadsAssigned:10305322 NegativeStrandReadsAssigned:10231997 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207827 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207827-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,332,115 reads, 20,745,153 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52401 SRR3207827.ke.tsv 34699 SRR3207827.se.tsv 87100 total ==> SRR3207827.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1655 57.5037 Potri.005G024800.1.v4.1 1035 936 384.024 27.3561 Potri.004G059700.1.v4.1 961 862 43 3.32609 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 400.488 9.38929 Potri.016G087400.1.v4.1 270 171 720.92 281.102 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 83 3.30594 Potri.012G127500.1.v4.1 977 878 5943 451.319 ==> SRR3207827.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2280 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 510 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 27 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207827 completed mapping pipeline successfully