Starting /dee2/code/volunteer_pipeline.sh SRR3207828 current disk space = 3056967229440 free memory = 1578561624 SRR3207828 SRAfilesize 5a9399d2a76f1347dc5def03d445f02d SRR3207828.sra SRR3207828.sra file validated SRR3207828 is single end SRR3207828 is conventional basespace SRR3207828 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207828_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.41675 34.0 33.0 34.0 31.0 34.0 2 33.12925 34.0 34.0 34.0 31.0 34.0 3 33.16975 34.0 33.0 34.0 31.0 34.0 4 36.514 37.0 37.0 37.0 35.0 37.0 5 36.646 37.0 37.0 37.0 35.0 37.0 6 36.71975 37.0 37.0 37.0 37.0 37.0 7 36.77475 37.0 37.0 37.0 37.0 37.0 8 36.7505 37.0 37.0 37.0 37.0 37.0 9 38.722 39.0 39.0 39.0 39.0 39.0 10-11 38.72775 39.0 39.0 39.0 39.0 39.0 12-13 38.703500000000005 39.0 39.0 39.0 38.5 39.0 14-15 40.441375 41.0 41.0 41.0 39.0 41.0 16-17 40.3885 41.0 41.0 41.0 39.0 41.0 18-19 40.37325 41.0 41.0 41.0 39.0 41.0 20-21 40.296375 41.0 40.0 41.0 39.0 41.0 22-23 40.228624999999994 41.0 40.0 41.0 39.0 41.0 24-25 40.134 41.0 40.0 41.0 38.5 41.0 26-27 40.00675 41.0 40.0 41.0 38.0 41.0 28-29 39.849125 41.0 40.0 41.0 38.0 41.0 30-31 39.721125 41.0 40.0 41.0 38.0 41.0 32-33 39.750375 41.0 40.0 41.0 38.0 41.0 34-35 39.656 41.0 40.0 41.0 38.0 41.0 36-37 39.540125 41.0 40.0 41.0 38.0 41.0 38-39 39.434875 41.0 40.0 41.0 37.0 41.0 40-41 39.252 41.0 40.0 41.0 37.0 41.0 42-43 39.5275 41.0 40.0 41.0 38.0 41.0 44-45 39.478 41.0 40.0 41.0 37.5 41.0 46-47 39.394125 41.0 40.0 41.0 37.0 41.0 48-49 39.307625 41.0 40.0 41.0 37.0 41.0 50-51 39.108625 41.0 40.0 41.0 36.0 41.0 52-53 38.972 41.0 39.0 41.0 36.0 41.0 54-55 38.775375 41.0 39.0 41.0 35.0 41.0 56-57 38.564750000000004 41.0 39.0 41.0 35.0 41.0 58-59 38.355125 40.0 38.0 41.0 35.0 41.0 60-61 38.01925 40.0 38.0 41.0 34.0 41.0 62-63 37.81675 40.0 37.0 41.0 34.0 41.0 64-65 37.490375 39.5 37.0 41.0 34.0 41.0 66-67 37.061 39.0 36.0 41.0 33.0 41.0 68-69 36.408500000000004 38.5 35.0 40.5 31.5 41.0 70-71 35.9415 37.0 35.0 39.5 31.5 41.0 72-73 35.611000000000004 37.0 35.0 39.0 31.5 41.0 74-75 35.145125 36.5 35.0 39.0 31.0 40.5 76-77 34.055375 35.5 34.0 37.0 29.5 39.0 78-79 34.133125 35.0 34.0 37.0 30.5 39.0 80-81 33.75875 35.0 34.0 37.0 30.0 38.0 82-83 33.44075 35.0 34.0 36.0 30.0 37.0 84-85 33.080625 35.0 34.0 36.0 29.5 37.0 86-87 32.819125 35.0 34.0 35.5 29.0 36.5 88-89 32.476749999999996 35.0 34.0 35.0 29.0 36.0 90-91 32.205375000000004 35.0 34.0 35.0 27.5 36.0 92-93 31.95025 35.0 33.5 35.0 26.5 36.0 94-95 31.752375 35.0 33.0 35.0 26.0 35.5 96-97 31.586750000000002 35.0 33.0 35.0 25.5 35.0 98-99 31.241999999999997 35.0 33.0 35.0 24.5 35.0 100 30.86275 35.0 33.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 3.0 11 5.0 12 1.0 13 5.0 14 7.0 15 4.0 16 8.0 17 9.0 18 9.0 19 6.0 20 18.0 21 14.0 22 12.0 23 10.0 24 10.0 25 13.0 26 17.0 27 13.0 28 21.0 29 21.0 30 23.0 31 35.0 32 38.0 33 53.0 34 89.0 35 140.0 36 305.0 37 879.0 38 1791.0 39 440.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.590955806783143 14.799588900308326 18.03699897225077 41.57245632065776 2 20.474999999999998 23.45 37.35 18.725 3 21.525 27.075 28.475 22.925 4 24.361542313470206 31.97295943915874 21.156735102653982 22.508763144717076 5 25.324999999999996 34.75 22.45 17.474999999999998 6 18.15 37.625 24.2 20.025000000000002 7 16.150000000000002 16.05 44.85 22.95 8 18.099999999999998 24.2 30.025000000000002 27.675 9 20.849999999999998 23.175 30.675 25.3 10-11 22.325 33.575 22.45 21.65 12-13 20.225 25.837500000000002 30.7375 23.200000000000003 14-15 20.5375 27.6 29.45 22.412499999999998 16-17 21.2875 28.050000000000004 28.349999999999998 22.3125 18-19 22.175 28.262500000000003 27.3 22.2625 20-21 21.175 28.849999999999998 27.700000000000003 22.275 22-23 21.3875 29.2875 27.287499999999998 22.037499999999998 24-25 21.1625 29.0875 27.5875 22.162499999999998 26-27 21.837500000000002 29.15 27.5625 21.45 28-29 21.587500000000002 28.3125 28.299999999999997 21.8 30-31 20.875 28.95 27.950000000000003 22.225 32-33 21.462500000000002 28.812500000000004 28.349999999999998 21.375 34-35 21.675 28.962500000000002 27.55 21.8125 36-37 21.875 28.499999999999996 27.775 21.85 38-39 21.0125 28.762500000000003 28.849999999999998 21.375 40-41 21.65 28.3125 28.762500000000003 21.275 42-43 21.9375 28.349999999999998 28.512500000000003 21.2 44-45 22.2 28.812500000000004 26.375 22.6125 46-47 21.325 28.475 27.6625 22.537499999999998 48-49 20.674999999999997 28.487499999999997 28.4375 22.400000000000002 50-51 22.0125 28.725 27.375 21.8875 52-53 22.5875 26.924999999999997 28.675 21.8125 54-55 21.025 28.7375 29.099999999999998 21.1375 56-57 21.762500000000003 28.537499999999998 27.6625 22.037499999999998 58-59 22.175 27.187499999999996 29.225 21.4125 60-61 21.15 28.225 28.125 22.5 62-63 21.4375 28.287499999999998 28.95 21.325 64-65 22.175 27.5625 28.6375 21.625 66-67 22.25 27.212500000000002 28.449999999999996 22.0875 68-69 22.25 26.6125 28.3625 22.775000000000002 70-71 21.3125 28.762500000000003 27.925 22.0 72-73 21.637500000000003 28.537499999999998 28.012500000000003 21.8125 74-75 21.0125 28.4375 28.875 21.675 76-77 21.762500000000003 28.025 28.875 21.337500000000002 78-79 21.375 27.9375 28.8375 21.85 80-81 21.45 28.15 28.675 21.725 82-83 21.45 28.6375 27.925 21.987499999999997 84-85 21.625 27.987499999999997 28.275 22.112499999999997 86-87 21.349999999999998 27.875 28.175 22.6 88-89 21.95 27.85 28.1375 22.0625 90-91 22.0125 27.3625 28.9375 21.6875 92-93 22.2 28.125 28.249999999999996 21.425 94-95 22.55 27.650000000000002 28.9875 20.8125 96-97 22.3125 28.487499999999997 28.1 21.099999999999998 98-99 22.075 28.9875 27.9125 21.025 100 21.45 27.450000000000003 27.650000000000002 23.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 2.5 25 5.0 26 8.5 27 13.0 28 15.5 29 18.0 30 22.0 31 29.0 32 37.0 33 54.5 34 72.0 35 86.5 36 97.0 37 110.0 38 142.5 39 188.0 40 215.0 41 225.5 42 247.0 43 252.5 44 261.5 45 270.0 46 246.0 47 221.0 48 213.0 49 193.0 50 166.0 51 130.5 52 97.5 53 77.5 54 56.5 55 41.5 56 32.0 57 26.0 58 25.0 59 24.0 60 14.5 61 13.0 62 11.0 63 6.5 64 5.0 65 4.0 66 4.0 67 2.0 68 1.0 69 1.0 70 2.0 71 3.0 72 1.5 73 0.0 74 0.5 75 1.0 76 1.5 77 1.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.7 2 0.0 3 0.0 4 0.15 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTGTG 20 0.002009417 70.49062 5 CTTGTGG 25 0.004866334 56.392498 6 >>END_MODULE Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854129 spots for SRR3207828.sra Written 854129 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra Read 854120 spots for SRR3207828.sra Written 854120 spots for SRR3207828.sra SRR ids: ['SRR3207828.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t6uq9w3o SRR3207828.sra spots: 17082409 blocks: [[1, 854120], [854121, 1708240], [1708241, 2562360], [2562361, 3416480], [3416481, 4270600], [4270601, 5124720], [5124721, 5978840], [5978841, 6832960], [6832961, 7687080], [7687081, 8541200], [8541201, 9395320], [9395321, 10249440], [10249441, 11103560], [11103561, 11957680], [11957681, 12811800], [12811801, 13665920], [13665921, 14520040], [14520041, 15374160], [15374161, 16228280], [16228281, 17082409]] SRR3207828 file size 4434968 SRR3207828 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207828 SRR3207828_1.fastq Input file: SRR3207828_1.fastq trimmed: SRR3207828-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 02:50:51 2025 >> started Tue Feb 11 02:56:52 2025 >> done (361.255s) 17082409 reads processed; of these: 3392 ( 0.02%) short reads filtered out after trimming by size control 15128 ( 0.09%) empty reads filtered out after trimming by size control 17063889 (99.89%) reads available; of these: 1091465 ( 6.40%) trimmed reads available after processing 15972424 (93.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 643 0.00% 19 810 0.00% 20 978 0.01% 21 1391 0.01% 22 2166 0.01% 23 2983 0.02% 24 3838 0.02% 25 5025 0.03% 26 4902 0.03% 27 4803 0.03% 28 5189 0.03% 29 5027 0.03% 30 5250 0.03% 31 5211 0.03% 32 5306 0.03% 33 5363 0.03% 34 5418 0.03% 35 5732 0.03% 36 5697 0.03% 37 5830 0.03% 38 6014 0.04% 39 5966 0.03% 40 5935 0.03% 41 5788 0.03% 42 5568 0.03% 43 6153 0.04% 44 6370 0.04% 45 6646 0.04% 46 7002 0.04% 47 7216 0.04% 48 7159 0.04% 49 7340 0.04% 50 7414 0.04% 51 7618 0.04% 52 7729 0.05% 53 7808 0.05% 54 7918 0.05% 55 8001 0.05% 56 8334 0.05% 57 9209 0.05% 58 9160 0.05% 59 8958 0.05% 60 8978 0.05% 61 8913 0.05% 62 9197 0.05% 63 9294 0.05% 64 9298 0.05% 65 9677 0.06% 66 9861 0.06% 67 10295 0.06% 68 10773 0.06% 69 10962 0.06% 70 10874 0.06% 71 10905 0.06% 72 11524 0.07% 73 11571 0.07% 74 11713 0.07% 75 12263 0.07% 76 9244 0.05% 77 9593 0.06% 78 11559 0.07% 79 11848 0.07% 80 12356 0.07% 81 13013 0.08% 82 13869 0.08% 83 15043 0.09% 84 15484 0.09% 85 16814 0.10% 86 17872 0.10% 87 17241 0.10% 88 18087 0.11% 89 20072 0.12% 90 21572 0.13% 91 24450 0.14% 92 29171 0.17% 93 32594 0.19% 94 36980 0.22% 95 43584 0.26% 96 54071 0.32% 97 69176 0.41% 98 76521 0.45% 99 94285 0.55% 100 15972424 93.60% 17063889 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=25.25 fanout-score-rank=20 prefix-density=0.17 prefix-fanout=21.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACC criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=264.13 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=25.4 sequence=TTCTTCTTCTTC Started job on | Feb 11 03:04:20 Started mapping on | Feb 11 03:04:26 Finished on | Feb 11 03:52:47 Mapping speed, Million of reads per hour | 21.18 Number of input reads | 17063889 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 16386640 Uniquely mapped reads % | 96.03% Average mapped length | 98.41 Number of splices: Total | 4482960 Number of splices: Annotated (sjdb) | 4390853 Number of splices: GT/AG | 4412512 Number of splices: GC/AG | 57640 Number of splices: AT/AC | 4713 Number of splices: Non-canonical | 8095 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394466 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 187473 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 282783 282783 282783 N_multimapping 394466 394466 394466 N_noFeature 799505 8515235 8548671 N_ambiguous 182664 30236 30483 UnstrandedReadsAssigned:15404471 PositiveStrandReadsAssigned:7841169 NegativeStrandReadsAssigned:7807486 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207828 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207828-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,063,889 reads, 15,858,016 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,244 rounds 52401 SRR3207828.ke.tsv 34699 SRR3207828.se.tsv 87100 total ==> SRR3207828.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 875 39.7494 Potri.005G024800.1.v4.1 1035 936 186 17.3235 Potri.004G059700.1.v4.1 961 862 24 2.42718 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 280.335 8.59303 Potri.016G087400.1.v4.1 270 171 607.445 309.677 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 79 4.11405 Potri.012G127500.1.v4.1 977 878 5470 543.114 ==> SRR3207828.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1771 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 341 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207828 completed mapping pipeline successfully