Starting /dee2/code/volunteer_pipeline.sh SRR3207829 current disk space = 3055378792448 free memory = 1220741736 SRR3207829 SRAfilesize 28055657724aac02129481a2196cdb7c SRR3207829.sra SRR3207829.sra file validated SRR3207829 is single end SRR3207829 is conventional basespace SRR3207829 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207829_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5155 34.0 33.0 34.0 31.0 34.0 2 33.12875 34.0 34.0 34.0 31.0 34.0 3 33.0535 34.0 33.0 34.0 31.0 34.0 4 36.5055 37.0 37.0 37.0 35.0 37.0 5 36.607 37.0 37.0 37.0 35.0 37.0 6 36.71225 37.0 37.0 37.0 36.0 37.0 7 36.6875 37.0 37.0 37.0 36.0 37.0 8 36.73325 37.0 37.0 37.0 37.0 37.0 9 38.7055 39.0 39.0 39.0 39.0 39.0 10-11 38.681375 39.0 39.0 39.0 38.0 39.0 12-13 38.621624999999995 39.0 39.0 39.0 38.0 39.0 14-15 40.227875 41.0 40.0 41.0 38.5 41.0 16-17 40.282624999999996 41.0 40.0 41.0 39.0 41.0 18-19 40.29775 41.0 40.0 41.0 39.0 41.0 20-21 40.24025 41.0 40.0 41.0 39.0 41.0 22-23 40.122749999999996 41.0 40.0 41.0 38.0 41.0 24-25 40.107 41.0 40.0 41.0 38.0 41.0 26-27 39.977625 41.0 40.0 41.0 38.0 41.0 28-29 39.8545 41.0 40.0 41.0 38.0 41.0 30-31 39.748125 41.0 40.0 41.0 38.0 41.0 32-33 39.723124999999996 41.0 40.0 41.0 38.0 41.0 34-35 39.458 41.0 40.0 41.0 37.0 41.0 36-37 39.291 41.0 40.0 41.0 37.0 41.0 38-39 39.29675 41.0 39.5 41.0 37.0 41.0 40-41 39.208124999999995 41.0 39.0 41.0 37.0 41.0 42-43 39.426500000000004 41.0 40.0 41.0 37.0 41.0 44-45 39.446625 41.0 40.0 41.0 37.0 41.0 46-47 39.4165 41.0 40.0 41.0 37.0 41.0 48-49 39.287125 41.0 40.0 41.0 37.0 41.0 50-51 39.158500000000004 41.0 40.0 41.0 37.0 41.0 52-53 39.004374999999996 41.0 39.0 41.0 36.0 41.0 54-55 38.757875 41.0 39.0 41.0 35.0 41.0 56-57 38.611999999999995 40.0 39.0 41.0 35.0 41.0 58-59 38.386125 40.0 38.0 41.0 34.5 41.0 60-61 38.089 40.0 38.0 41.0 34.0 41.0 62-63 37.856375 40.0 37.0 41.0 34.0 41.0 64-65 37.44675 39.5 36.5 41.0 33.5 41.0 66-67 37.0985 39.0 36.0 41.0 33.0 41.0 68-69 36.595 38.5 35.0 40.5 32.0 41.0 70-71 36.155625 37.5 35.0 40.0 32.0 41.0 72-73 35.64925 37.0 35.0 39.0 32.0 41.0 74-75 35.129375 36.5 35.0 39.0 31.0 40.5 76-77 34.18125 35.5 34.0 37.0 29.5 39.0 78-79 34.282375 35.5 35.0 37.0 31.0 39.0 80-81 33.902625 35.0 34.0 37.0 30.5 38.5 82-83 33.574 35.0 34.0 36.0 30.0 37.0 84-85 33.230125 35.0 34.0 36.0 30.0 37.0 86-87 32.980374999999995 35.0 34.0 35.5 29.0 36.5 88-89 32.764125 35.0 34.0 35.0 29.0 36.0 90-91 32.569125 35.0 34.0 35.0 29.0 36.0 92-93 32.363125 35.0 34.0 35.0 29.0 36.0 94-95 32.114000000000004 35.0 34.0 35.0 28.0 35.5 96-97 31.823999999999998 35.0 33.0 35.0 27.0 35.0 98-99 31.52775 35.0 33.0 35.0 25.0 35.0 100 31.32925 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 3.0 11 5.0 12 6.0 13 2.0 14 1.0 15 5.0 16 6.0 17 4.0 18 13.0 19 3.0 20 6.0 21 9.0 22 7.0 23 15.0 24 18.0 25 16.0 26 10.0 27 24.0 28 21.0 29 32.0 30 24.0 31 32.0 32 48.0 33 44.0 34 80.0 35 152.0 36 346.0 37 838.0 38 1755.0 39 473.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.260557972869208 15.459431789096492 17.225492705400562 41.05451753263373 2 18.625 24.3 37.75 19.325 3 21.6 27.575 28.175 22.650000000000002 4 23.892919689767325 32.22416812609457 21.09081811358519 22.792094070552913 5 23.775 35.35 22.45 18.425 6 18.15 37.65 23.549999999999997 20.65 7 15.75 17.0 45.35 21.9 8 19.225 22.3 30.275000000000002 28.199999999999996 9 19.900000000000002 24.224999999999998 29.7 26.174999999999997 10-11 22.325 33.7375 21.9625 21.975 12-13 20.3 26.275 30.2 23.225 14-15 20.875 27.325 29.1375 22.662499999999998 16-17 21.6875 27.55 28.537499999999998 22.225 18-19 22.0625 27.975 27.1375 22.825 20-21 21.712500000000002 28.525 27.325 22.4375 22-23 21.4 28.8375 27.3625 22.400000000000002 24-25 20.837500000000002 29.212500000000002 28.1 21.85 26-27 21.587500000000002 28.5875 28.3125 21.512500000000003 28-29 21.6125 27.675 28.4125 22.3 30-31 22.162499999999998 28.462500000000002 27.9375 21.4375 32-33 21.224999999999998 29.0875 27.8375 21.85 34-35 21.475 28.449999999999996 28.0625 22.0125 36-37 21.4 27.474999999999998 27.800000000000004 23.325000000000003 38-39 21.65 28.749999999999996 27.287499999999998 22.3125 40-41 21.912499999999998 29.049999999999997 28.050000000000004 20.9875 42-43 21.3 28.4375 28.212500000000002 22.05 44-45 21.5625 27.787499999999998 27.8125 22.8375 46-47 21.712500000000002 29.4125 27.287499999999998 21.587500000000002 48-49 21.425 28.962500000000002 27.775 21.837500000000002 50-51 21.65 28.449999999999996 28.15 21.75 52-53 21.3125 28.625 27.450000000000003 22.6125 54-55 21.762500000000003 27.9375 28.000000000000004 22.3 56-57 22.900000000000002 27.950000000000003 27.625 21.525 58-59 21.825 28.025 28.299999999999997 21.85 60-61 22.3375 28.325 27.287499999999998 22.05 62-63 22.0125 27.3375 28.000000000000004 22.650000000000002 64-65 21.8625 28.4125 27.500000000000004 22.225 66-67 22.3875 27.8375 27.737499999999997 22.037499999999998 68-69 22.175 27.8625 27.9125 22.05 70-71 21.4375 26.8625 29.1875 22.5125 72-73 21.4875 28.000000000000004 28.349999999999998 22.162499999999998 74-75 22.525000000000002 28.287499999999998 27.400000000000002 21.7875 76-77 22.1 28.249999999999996 28.349999999999998 21.3 78-79 23.275000000000002 26.7625 27.737499999999997 22.225 80-81 22.75 28.625 27.462500000000002 21.1625 82-83 22.0875 28.199999999999996 28.037499999999998 21.675 84-85 21.8875 29.1625 27.5875 21.3625 86-87 21.987499999999997 27.8625 28.199999999999996 21.95 88-89 21.462500000000002 28.6375 28.237499999999997 21.6625 90-91 21.7875 28.3875 28.425 21.4 92-93 22.412499999999998 28.1625 27.750000000000004 21.675 94-95 22.2625 27.5875 28.0625 22.0875 96-97 22.0625 27.950000000000003 28.000000000000004 21.987499999999997 98-99 22.35 27.487499999999997 27.6 22.5625 100 22.325 28.349999999999998 28.999999999999996 20.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.5 24 3.5 25 4.0 26 6.0 27 6.0 28 8.0 29 16.0 30 23.5 31 28.5 32 32.0 33 48.5 34 69.0 35 84.0 36 106.5 37 120.5 38 138.0 39 161.0 40 199.5 41 228.0 42 231.5 43 240.0 44 254.0 45 269.5 46 281.5 47 247.0 48 198.5 49 182.0 50 161.5 51 138.0 52 107.5 53 87.5 54 70.5 55 49.5 56 40.5 57 33.0 58 19.0 59 12.5 60 14.0 61 11.0 62 10.5 63 10.0 64 6.5 65 5.0 66 3.0 67 2.0 68 3.5 69 4.0 70 3.5 71 2.5 72 3.0 73 3.5 74 2.0 75 0.5 76 0.0 77 0.0 78 0.5 79 1.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.325 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060319 spots for SRR3207829.sra Written 1060319 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra Read 1060316 spots for SRR3207829.sra Written 1060316 spots for SRR3207829.sra SRR ids: ['SRR3207829.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vhws8zvi SRR3207829.sra spots: 21206323 blocks: [[1, 1060316], [1060317, 2120632], [2120633, 3180948], [3180949, 4241264], [4241265, 5301580], [5301581, 6361896], [6361897, 7422212], [7422213, 8482528], [8482529, 9542844], [9542845, 10603160], [10603161, 11663476], [11663477, 12723792], [12723793, 13784108], [13784109, 14844424], [14844425, 15904740], [15904741, 16965056], [16965057, 18025372], [18025373, 19085688], [19085689, 20146004], [20146005, 21206323]] SRR3207829 file size 5508209 SRR3207829 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207829 SRR3207829_1.fastq Input file: SRR3207829_1.fastq trimmed: SRR3207829-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 04:55:06 2025 >> started Tue Feb 11 05:01:21 2025 >> done (374.828s) 21206323 reads processed; of these: 3945 ( 0.02%) short reads filtered out after trimming by size control 29460 ( 0.14%) empty reads filtered out after trimming by size control 21172918 (99.84%) reads available; of these: 1130927 ( 5.34%) trimmed reads available after processing 20041991 (94.66%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 733 0.00% 19 1003 0.00% 20 1320 0.01% 21 1508 0.01% 22 2178 0.01% 23 3118 0.01% 24 4114 0.02% 25 5472 0.03% 26 5902 0.03% 27 6313 0.03% 28 6025 0.03% 29 5968 0.03% 30 6266 0.03% 31 6066 0.03% 32 6258 0.03% 33 6052 0.03% 34 6387 0.03% 35 6288 0.03% 36 6450 0.03% 37 6711 0.03% 38 6953 0.03% 39 6749 0.03% 40 6728 0.03% 41 6755 0.03% 42 6903 0.03% 43 7028 0.03% 44 7265 0.03% 45 7803 0.04% 46 7992 0.04% 47 8186 0.04% 48 8410 0.04% 49 8553 0.04% 50 8532 0.04% 51 8876 0.04% 52 9046 0.04% 53 9226 0.04% 54 9577 0.05% 55 9626 0.05% 56 9976 0.05% 57 9362 0.04% 58 9630 0.05% 59 9635 0.05% 60 9944 0.05% 61 9921 0.05% 62 10192 0.05% 63 9765 0.05% 64 10194 0.05% 65 10670 0.05% 66 10604 0.05% 67 10833 0.05% 68 11330 0.05% 69 11280 0.05% 70 11377 0.05% 71 11920 0.06% 72 12305 0.06% 73 12084 0.06% 74 12216 0.06% 75 12549 0.06% 76 9382 0.04% 77 10204 0.05% 78 11692 0.06% 79 12084 0.06% 80 12961 0.06% 81 13161 0.06% 82 13827 0.07% 83 14936 0.07% 84 15728 0.07% 85 16592 0.08% 86 17050 0.08% 87 18572 0.09% 88 19452 0.09% 89 20814 0.10% 90 22427 0.11% 91 25364 0.12% 92 29654 0.14% 93 33384 0.16% 94 37670 0.18% 95 44033 0.21% 96 51792 0.24% 97 64479 0.30% 98 74573 0.35% 99 86969 0.41% 100 20041991 94.66% 21172918 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=21.48 fanout-score-rank=13 prefix-density=0.16 prefix-fanout=20.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=19 fanout-score=304.99 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=28.4 sequence=TTCTTCTTCTTC Started job on | Feb 11 05:08:07 Started mapping on | Feb 11 05:08:21 Finished on | Feb 11 05:50:23 Mapping speed, Million of reads per hour | 30.22 Number of input reads | 21172918 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 19954076 Uniquely mapped reads % | 94.24% Average mapped length | 98.59 Number of splices: Total | 5583502 Number of splices: Annotated (sjdb) | 5469159 Number of splices: GT/AG | 5495776 Number of splices: GC/AG | 71916 Number of splices: AT/AC | 5892 Number of splices: Non-canonical | 9918 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.12 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 507383 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 585984 % of reads mapped to too many loci | 2.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.58% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 711459 711459 711459 N_multimapping 507383 507383 507383 N_noFeature 968532 10374540 10412850 N_ambiguous 208680 36704 37120 UnstrandedReadsAssigned:18776864 PositiveStrandReadsAssigned:9542832 NegativeStrandReadsAssigned:9504106 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207829 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207829-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,172,918 reads, 19,637,105 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR3207829.ke.tsv 34699 SRR3207829.se.tsv 87100 total ==> SRR3207829.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1017 37.5025 Potri.005G024800.1.v4.1 1035 936 337 25.4782 Potri.004G059700.1.v4.1 961 862 22 1.80605 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 431.165 10.7282 Potri.016G087400.1.v4.1 270 171 827 342.235 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 109 4.60771 Potri.012G127500.1.v4.1 977 878 4244 342.054 ==> SRR3207829.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1904 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 417 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207829 completed mapping pipeline successfully