Starting /dee2/code/volunteer_pipeline.sh SRR3207830 current disk space = 3055172108288 free memory = 1569967096 SRR3207830 SRAfilesize fc4f2fe28cd6ff9fd0c73d43ade00567 SRR3207830.sra SRR3207830.sra file validated SRR3207830 is single end SRR3207830 is conventional basespace SRR3207830 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207830_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91075 34.0 33.0 34.0 31.0 34.0 2 33.35425 34.0 34.0 34.0 31.0 34.0 3 33.1475 34.0 33.0 34.0 31.0 34.0 4 36.453 37.0 37.0 37.0 35.0 37.0 5 36.63425 37.0 37.0 37.0 35.0 37.0 6 36.714 37.0 37.0 37.0 36.0 37.0 7 36.7095 37.0 37.0 37.0 36.0 37.0 8 36.73975 37.0 37.0 37.0 36.0 37.0 9 38.6945 39.0 39.0 39.0 39.0 39.0 10-11 38.71425 39.0 39.0 39.0 39.0 39.0 12-13 38.638000000000005 39.0 39.0 39.0 38.0 39.0 14-15 40.27475 41.0 40.0 41.0 39.0 41.0 16-17 40.372875 41.0 40.5 41.0 39.0 41.0 18-19 40.337374999999994 41.0 40.0 41.0 39.0 41.0 20-21 40.307500000000005 41.0 40.0 41.0 39.0 41.0 22-23 40.196124999999995 41.0 40.0 41.0 39.0 41.0 24-25 40.116749999999996 41.0 40.0 41.0 38.0 41.0 26-27 40.024125 41.0 40.0 41.0 38.0 41.0 28-29 39.940124999999995 41.0 40.0 41.0 38.0 41.0 30-31 39.86825 41.0 40.0 41.0 38.0 41.0 32-33 39.755375 41.0 40.0 41.0 38.0 41.0 34-35 39.517624999999995 41.0 40.0 41.0 37.5 41.0 36-37 39.30875 41.0 40.0 41.0 37.0 41.0 38-39 39.348 41.0 40.0 41.0 37.0 41.0 40-41 39.213499999999996 41.0 39.0 41.0 37.0 41.0 42-43 39.41775 41.0 40.0 41.0 37.0 41.0 44-45 39.528375 41.0 40.0 41.0 37.5 41.0 46-47 39.472750000000005 41.0 40.0 41.0 37.0 41.0 48-49 39.358374999999995 41.0 40.0 41.0 37.0 41.0 50-51 39.249125 41.0 40.0 41.0 36.5 41.0 52-53 39.13175 41.0 39.0 41.0 36.0 41.0 54-55 38.843625 41.0 39.0 41.0 35.0 41.0 56-57 38.5985 40.5 39.0 41.0 35.0 41.0 58-59 38.334125 40.0 38.0 41.0 34.5 41.0 60-61 38.138 40.0 38.0 41.0 34.0 41.0 62-63 37.860375 40.0 37.0 41.0 34.0 41.0 64-65 37.485749999999996 39.5 36.5 41.0 34.0 41.0 66-67 37.112875 39.0 36.0 41.0 33.5 41.0 68-69 36.702625 39.0 35.0 40.5 33.0 41.0 70-71 36.281 37.5 35.0 39.5 32.0 41.0 72-73 35.785875000000004 37.0 35.0 39.0 32.0 41.0 74-75 35.289375 36.5 35.0 39.0 32.0 40.5 76-77 34.278625000000005 35.5 34.0 37.0 30.5 39.0 78-79 34.354875 35.0 34.5 37.0 31.0 39.0 80-81 34.007999999999996 35.0 35.0 37.0 31.0 39.0 82-83 33.619375000000005 35.0 34.0 36.0 30.0 37.0 84-85 33.28675 35.0 34.0 36.0 30.0 37.0 86-87 33.08225 35.0 34.0 35.5 30.0 36.5 88-89 32.80225 35.0 34.0 35.0 29.0 36.0 90-91 32.579375 35.0 34.0 35.0 29.0 36.0 92-93 32.341375 35.0 34.0 35.0 29.0 36.0 94-95 32.0765 35.0 34.0 35.0 28.0 36.0 96-97 31.851374999999997 35.0 33.5 35.0 26.5 35.0 98-99 31.73425 35.0 33.0 35.0 27.0 35.0 100 31.60125 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 2.0 12 4.0 13 4.0 14 2.0 15 5.0 16 10.0 17 6.0 18 7.0 19 9.0 20 6.0 21 10.0 22 10.0 23 11.0 24 13.0 25 8.0 26 18.0 27 18.0 28 29.0 29 17.0 30 26.0 31 33.0 32 43.0 33 54.0 34 83.0 35 137.0 36 295.0 37 807.0 38 1875.0 39 455.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.935288169868553 16.456016177957533 18.554095045500503 39.054600606673404 2 20.4 23.7 36.175000000000004 19.725 3 22.75 25.85 28.95 22.45 4 23.227261338010525 33.324981207717364 20.370834377349034 23.076923076923077 5 25.0 35.05 21.9 18.05 6 20.1 37.05 22.8 20.05 7 16.675 18.65 43.675000000000004 21.0 8 18.55 24.349999999999998 28.249999999999996 28.849999999999998 9 19.75 24.3 29.525000000000002 26.424999999999997 10-11 21.425 35.425000000000004 22.225 20.925 12-13 21.0625 27.05 28.962500000000002 22.925 14-15 21.349999999999998 27.537499999999998 28.512500000000003 22.6 16-17 21.375 28.3625 28.025 22.237499999999997 18-19 20.8125 29.4125 27.35 22.425 20-21 22.05 28.9125 27.737499999999997 21.3 22-23 21.2 28.8625 28.075 21.8625 24-25 22.1375 29.1625 26.75 21.95 26-27 21.85 29.675 26.55 21.925 28-29 21.55 28.1875 27.800000000000004 22.4625 30-31 21.0625 28.287499999999998 28.225 22.425 32-33 21.45 27.975 28.325 22.25 34-35 21.425 29.2375 27.8125 21.525 36-37 21.875 28.849999999999998 27.712500000000002 21.5625 38-39 22.05 28.462500000000002 27.425 22.0625 40-41 21.4 28.962500000000002 27.737499999999997 21.9 42-43 21.675 28.499999999999996 28.025 21.8 44-45 21.95 28.5625 27.8375 21.65 46-47 21.9 29.1625 27.6 21.337500000000002 48-49 21.775 28.3625 27.950000000000003 21.912499999999998 50-51 21.7875 28.1125 27.825 22.275 52-53 21.099999999999998 29.45 28.6625 20.7875 54-55 21.3875 28.712500000000002 28.037499999999998 21.8625 56-57 22.075 27.925 28.4375 21.5625 58-59 22.075 28.3125 27.6125 22.0 60-61 21.6125 28.549999999999997 27.962500000000002 21.875 62-63 21.6125 28.262500000000003 28.7 21.425 64-65 22.412499999999998 27.8875 27.875 21.825 66-67 21.7375 28.6125 27.700000000000003 21.95 68-69 21.912499999999998 28.249999999999996 27.6 22.237499999999997 70-71 21.5375 28.4 28.6125 21.45 72-73 21.0125 29.037499999999998 28.237499999999997 21.712500000000002 74-75 22.0 27.775 28.1375 22.0875 76-77 22.3875 27.725 27.725 22.162499999999998 78-79 21.675 27.675 27.5625 23.0875 80-81 21.575 27.6 28.1625 22.662499999999998 82-83 21.7 29.037499999999998 27.437499999999996 21.825 84-85 21.825 28.5625 28.449999999999996 21.1625 86-87 22.275 28.449999999999996 28.6375 20.6375 88-89 22.5 28.6375 28.65 20.2125 90-91 21.087500000000002 27.287499999999998 29.325000000000003 22.3 92-93 21.762500000000003 28.5625 28.475 21.2 94-95 22.025 28.787499999999998 28.3875 20.8 96-97 22.2 27.750000000000004 28.787499999999998 21.2625 98-99 21.9375 29.037499999999998 27.962500000000002 21.0625 100 23.025000000000002 28.225 27.224999999999998 21.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 2.5 26 4.0 27 11.0 28 15.0 29 16.0 30 24.0 31 31.5 32 42.5 33 52.0 34 67.5 35 83.0 36 106.0 37 139.5 38 159.5 39 176.0 40 194.5 41 224.5 42 246.5 43 252.0 44 263.5 45 257.5 46 234.0 47 229.5 48 217.5 49 194.0 50 160.5 51 119.0 52 103.5 53 88.0 54 60.0 55 42.5 56 35.0 57 26.5 58 17.5 59 17.5 60 19.0 61 14.5 62 8.5 63 7.0 64 6.0 65 4.5 66 4.5 67 2.5 68 1.0 69 2.5 70 2.0 71 0.0 72 1.0 73 2.0 74 1.0 75 0.5 76 1.5 77 1.0 78 1.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.22499999999999998 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.0875 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610166 spots for SRR3207830.sra Written 610166 spots for SRR3207830.sra Read 610180 spots for SRR3207830.sra Written 610180 spots for SRR3207830.sra SRR ids: ['SRR3207830.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_56036kw6 SRR3207830.sra spots: 12203334 blocks: [[1, 610166], [610167, 1220332], [1220333, 1830498], [1830499, 2440664], [2440665, 3050830], [3050831, 3660996], [3660997, 4271162], [4271163, 4881328], [4881329, 5491494], [5491495, 6101660], [6101661, 6711826], [6711827, 7321992], [7321993, 7932158], [7932159, 8542324], [8542325, 9152490], [9152491, 9762656], [9762657, 10372822], [10372823, 10982988], [10982989, 11593154], [11593155, 12203334]] SRR3207830 file size 3165136 SRR3207830 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207830 SRR3207830_1.fastq Input file: SRR3207830_1.fastq trimmed: SRR3207830-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 04:53:27 2025 >> started Tue Feb 11 04:57:43 2025 >> done (256.003s) 12203334 reads processed; of these: 1859 ( 0.02%) short reads filtered out after trimming by size control 12628 ( 0.10%) empty reads filtered out after trimming by size control 12188847 (99.88%) reads available; of these: 617512 ( 5.07%) trimmed reads available after processing 11571335 (94.93%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 385 0.00% 19 560 0.00% 20 651 0.01% 21 790 0.01% 22 1174 0.01% 23 1723 0.01% 24 2248 0.02% 25 2980 0.02% 26 3146 0.03% 27 3370 0.03% 28 3433 0.03% 29 3289 0.03% 30 3385 0.03% 31 3355 0.03% 32 3481 0.03% 33 3430 0.03% 34 3517 0.03% 35 3617 0.03% 36 3691 0.03% 37 3721 0.03% 38 3855 0.03% 39 3682 0.03% 40 3629 0.03% 41 3717 0.03% 42 3671 0.03% 43 3822 0.03% 44 3915 0.03% 45 4159 0.03% 46 4317 0.04% 47 4285 0.04% 48 4465 0.04% 49 4724 0.04% 50 4606 0.04% 51 4919 0.04% 52 4885 0.04% 53 4959 0.04% 54 5306 0.04% 55 5305 0.04% 56 5432 0.04% 57 5136 0.04% 58 5311 0.04% 59 5193 0.04% 60 5493 0.05% 61 5503 0.05% 62 5566 0.05% 63 5488 0.05% 64 5430 0.04% 65 5888 0.05% 66 5840 0.05% 67 5938 0.05% 68 6071 0.05% 69 6086 0.05% 70 6335 0.05% 71 6415 0.05% 72 6777 0.06% 73 6697 0.05% 74 6640 0.05% 75 6710 0.06% 76 5086 0.04% 77 5706 0.05% 78 6202 0.05% 79 6546 0.05% 80 6754 0.06% 81 7158 0.06% 82 7588 0.06% 83 8037 0.07% 84 8447 0.07% 85 8840 0.07% 86 9318 0.08% 87 9971 0.08% 88 10409 0.09% 89 11323 0.09% 90 12229 0.10% 91 13611 0.11% 92 16101 0.13% 93 18286 0.15% 94 20583 0.17% 95 24018 0.20% 96 28383 0.23% 97 35108 0.29% 98 41211 0.34% 99 48481 0.40% 100 11571335 94.93% 12188847 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=23.26 fanout-score-rank=20 prefix-density=0.15 prefix-fanout=19.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACA criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=323.36 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=28.2 sequence=TTCTTCTTCTTC Started job on | Feb 11 05:09:39 Started mapping on | Feb 11 05:09:44 Finished on | Feb 11 06:09:04 Mapping speed, Million of reads per hour | 12.33 Number of input reads | 12188847 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 11625217 Uniquely mapped reads % | 95.38% Average mapped length | 98.64 Number of splices: Total | 3099667 Number of splices: Annotated (sjdb) | 3036842 Number of splices: GT/AG | 3050431 Number of splices: GC/AG | 40171 Number of splices: AT/AC | 3343 Number of splices: Non-canonical | 5722 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.02% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282638 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 211139 % of reads mapped to too many loci | 1.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.56% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 280992 280992 280992 N_multimapping 282638 282638 282638 N_noFeature 538794 6029586 6050977 N_ambiguous 125444 21019 21212 UnstrandedReadsAssigned:10960979 PositiveStrandReadsAssigned:5574612 NegativeStrandReadsAssigned:5553028 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207830 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207830-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,188,847 reads, 11,349,220 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR3207830.ke.tsv 34699 SRR3207830.se.tsv 87100 total ==> SRR3207830.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 669 42.1102 Potri.005G024800.1.v4.1 1035 936 161 20.7771 Potri.004G059700.1.v4.1 961 862 14 1.96181 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 211.27 8.97313 Potri.016G087400.1.v4.1 270 171 465 328.468 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 51 3.68002 Potri.012G127500.1.v4.1 977 878 3021 415.616 ==> SRR3207830.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1013 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207830 completed mapping pipeline successfully