Starting /dee2/code/volunteer_pipeline.sh SRR3207831 current disk space = 3055077814272 free memory = 1441918248 SRR3207831 SRAfilesize 358f6de749227bd32c7e0d78d2ee09ea SRR3207831.sra SRR3207831.sra file validated SRR3207831 is single end SRR3207831 is conventional basespace SRR3207831 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207831_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62475 34.0 33.0 34.0 31.0 34.0 2 33.224 34.0 34.0 34.0 31.0 34.0 3 33.1235 34.0 33.0 34.0 31.0 34.0 4 36.51025 37.0 37.0 37.0 35.0 37.0 5 36.63425 37.0 37.0 37.0 35.0 37.0 6 36.733 37.0 37.0 37.0 36.0 37.0 7 36.72375 37.0 37.0 37.0 36.0 37.0 8 36.7505 37.0 37.0 37.0 37.0 37.0 9 38.7305 39.0 39.0 39.0 39.0 39.0 10-11 38.684625 39.0 39.0 39.0 38.0 39.0 12-13 38.637875 39.0 39.0 39.0 38.0 39.0 14-15 40.296375 41.0 41.0 41.0 39.0 41.0 16-17 40.302125000000004 41.0 40.0 41.0 39.0 41.0 18-19 40.323375 41.0 40.0 41.0 39.0 41.0 20-21 40.26325 41.0 40.0 41.0 39.0 41.0 22-23 40.154875000000004 41.0 40.0 41.0 38.5 41.0 24-25 40.1165 41.0 40.0 41.0 38.0 41.0 26-27 40.06575 41.0 40.0 41.0 38.0 41.0 28-29 39.99425 41.0 40.0 41.0 38.0 41.0 30-31 39.844125 41.0 40.0 41.0 38.0 41.0 32-33 39.799375 41.0 40.0 41.0 38.0 41.0 34-35 39.57525 41.0 40.0 41.0 37.5 41.0 36-37 39.39875 41.0 40.0 41.0 37.0 41.0 38-39 39.426874999999995 41.0 40.0 41.0 37.0 41.0 40-41 39.33475 41.0 39.5 41.0 37.0 41.0 42-43 39.529375 41.0 40.0 41.0 37.5 41.0 44-45 39.62425 41.0 40.0 41.0 38.0 41.0 46-47 39.586 41.0 40.0 41.0 37.5 41.0 48-49 39.502375 41.0 40.0 41.0 37.0 41.0 50-51 39.373875 41.0 40.0 41.0 37.0 41.0 52-53 39.230375 41.0 40.0 41.0 36.0 41.0 54-55 39.010000000000005 41.0 39.0 41.0 36.0 41.0 56-57 38.803375 41.0 39.0 41.0 35.0 41.0 58-59 38.555499999999995 40.0 38.5 41.0 35.0 41.0 60-61 38.35 40.0 38.0 41.0 35.0 41.0 62-63 38.069374999999994 40.0 37.0 41.0 34.0 41.0 64-65 37.69975 39.5 36.5 41.0 34.0 41.0 66-67 37.30825 39.0 36.0 41.0 34.0 41.0 68-69 36.770375 39.0 35.5 40.5 33.0 41.0 70-71 36.42125 37.5 35.0 40.0 33.0 41.0 72-73 35.907 37.0 35.0 39.0 32.0 41.0 74-75 35.382625000000004 36.5 35.0 39.0 31.5 40.5 76-77 34.392875000000004 35.5 34.0 37.0 30.5 39.0 78-79 34.530249999999995 35.5 34.5 37.0 31.0 39.0 80-81 34.2 35.0 34.5 37.0 31.0 38.5 82-83 33.833 35.0 34.0 36.0 31.0 37.0 84-85 33.415125 35.0 34.0 36.0 30.0 37.0 86-87 33.23925 35.0 34.0 35.5 30.0 36.5 88-89 33.034499999999994 35.0 34.0 35.0 30.0 36.0 90-91 32.745625000000004 35.0 34.0 35.0 29.5 36.0 92-93 32.55625 35.0 34.0 35.0 29.0 36.0 94-95 32.315 35.0 34.0 35.0 29.0 35.0 96-97 31.967 35.0 33.0 35.0 27.0 35.0 98-99 31.849375000000002 35.0 33.0 35.0 27.5 35.0 100 31.627 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 2.0 12 2.0 13 4.0 14 4.0 15 1.0 16 7.0 17 4.0 18 9.0 19 6.0 20 7.0 21 7.0 22 10.0 23 17.0 24 7.0 25 10.0 26 8.0 27 14.0 28 16.0 29 25.0 30 23.0 31 38.0 32 38.0 33 64.0 34 98.0 35 130.0 36 296.0 37 834.0 38 1864.0 39 452.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.484693877551017 14.183673469387756 19.005102040816325 41.3265306122449 2 18.55 24.275 36.975 20.200000000000003 3 22.0 26.650000000000002 27.425 23.925 4 22.60325406758448 34.618272841051315 20.40050062578223 22.377972465581976 5 23.275000000000002 35.125 22.725 18.875 6 17.424999999999997 38.425 23.825 20.325 7 16.525000000000002 16.5 45.574999999999996 21.4 8 19.900000000000002 21.85 28.999999999999996 29.25 9 21.075 22.225 31.2 25.5 10-11 22.662499999999998 33.4375 22.1375 21.762500000000003 12-13 20.2625 26.3 30.325000000000003 23.1125 14-15 20.4125 27.925 29.1875 22.475 16-17 21.55 28.65 28.3875 21.4125 18-19 20.9375 28.15 27.775 23.1375 20-21 21.212500000000002 29.1625 27.6375 21.987499999999997 22-23 21.6625 29.9 27.650000000000002 20.7875 24-25 21.212500000000002 29.1875 28.000000000000004 21.6 26-27 21.2 29.1375 27.425 22.237499999999997 28-29 21.2 28.0875 28.349999999999998 22.3625 30-31 21.275 27.400000000000002 28.849999999999998 22.475 32-33 21.3875 29.3875 27.200000000000003 22.025 34-35 20.9375 28.787499999999998 28.299999999999997 21.975 36-37 21.337500000000002 29.062500000000004 27.5625 22.037499999999998 38-39 21.95 28.4375 27.725 21.8875 40-41 21.762500000000003 29.062500000000004 27.5875 21.587500000000002 42-43 21.25 29.25 27.712500000000002 21.7875 44-45 21.675 27.775 28.4375 22.112499999999997 46-47 21.8875 27.762500000000003 27.750000000000004 22.6 48-49 21.5 28.425 27.9125 22.162499999999998 50-51 21.4875 27.450000000000003 29.0875 21.975 52-53 21.462500000000002 28.0625 27.500000000000004 22.975 54-55 21.575 28.4375 27.712500000000002 22.275 56-57 21.875 28.262500000000003 28.199999999999996 21.6625 58-59 22.025 28.000000000000004 28.599999999999998 21.375 60-61 21.7 28.875 27.4125 22.0125 62-63 20.75 28.799999999999997 29.2875 21.1625 64-65 22.175 27.437499999999996 28.6125 21.775 66-67 22.15 28.025 28.199999999999996 21.625 68-69 23.2625 28.175 27.175 21.3875 70-71 21.7875 28.487499999999997 27.575 22.15 72-73 22.162499999999998 28.037499999999998 27.650000000000002 22.15 74-75 22.650000000000002 28.262500000000003 28.000000000000004 21.087500000000002 76-77 22.125 27.474999999999998 28.287499999999998 22.112499999999997 78-79 21.512500000000003 29.099999999999998 27.675 21.712500000000002 80-81 21.8 28.6125 27.575 22.0125 82-83 21.7875 27.650000000000002 28.299999999999997 22.2625 84-85 21.6625 27.55 28.4 22.3875 86-87 22.412499999999998 28.287499999999998 27.85 21.45 88-89 22.3375 27.6625 28.1625 21.837500000000002 90-91 22.0875 27.700000000000003 28.212500000000002 22.0 92-93 22.05 28.799999999999997 27.1125 22.037499999999998 94-95 22.4375 28.237499999999997 28.237499999999997 21.087500000000002 96-97 22.650000000000002 27.787499999999998 28.0875 21.475 98-99 23.474999999999998 27.825 27.487499999999997 21.212500000000002 100 21.75 28.025 28.275 21.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.5 24 4.0 25 4.0 26 5.5 27 8.5 28 9.0 29 11.5 30 16.0 31 23.5 32 40.0 33 54.5 34 63.5 35 82.5 36 99.5 37 109.5 38 136.0 39 165.5 40 202.5 41 244.5 42 253.0 43 251.0 44 258.5 45 270.0 46 273.0 47 248.5 48 209.0 49 188.5 50 164.0 51 123.0 52 99.0 53 94.5 54 76.0 55 50.5 56 40.0 57 29.5 58 18.0 59 12.0 60 9.5 61 6.5 62 5.5 63 4.0 64 5.0 65 7.5 66 5.5 67 2.5 68 2.0 69 1.5 70 1.5 71 1.0 72 0.0 73 0.5 74 0.5 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.0 3 0.0 4 0.125 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra Read 848496 spots for SRR3207831.sra Written 848496 spots for SRR3207831.sra Read 848478 spots for SRR3207831.sra Written 848478 spots for SRR3207831.sra SRR ids: ['SRR3207831.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5fxb63kf SRR3207831.sra spots: 16969578 blocks: [[1, 848478], [848479, 1696956], [1696957, 2545434], [2545435, 3393912], [3393913, 4242390], [4242391, 5090868], [5090869, 5939346], [5939347, 6787824], [6787825, 7636302], [7636303, 8484780], [8484781, 9333258], [9333259, 10181736], [10181737, 11030214], [11030215, 11878692], [11878693, 12727170], [12727171, 13575648], [13575649, 14424126], [14424127, 15272604], [15272605, 16121082], [16121083, 16969578]] SRR3207831 file size 4405570 SRR3207831 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207831 SRR3207831_1.fastq Input file: SRR3207831_1.fastq trimmed: SRR3207831-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 05:16:17 2025 >> started Tue Feb 11 05:21:21 2025 >> done (303.276s) 16969578 reads processed; of these: 3479 ( 0.02%) short reads filtered out after trimming by size control 19004 ( 0.11%) empty reads filtered out after trimming by size control 16947095 (99.87%) reads available; of these: 858135 ( 5.06%) trimmed reads available after processing 16088960 (94.94%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 563 0.00% 19 811 0.00% 20 983 0.01% 21 1206 0.01% 22 1629 0.01% 23 2373 0.01% 24 2957 0.02% 25 3993 0.02% 26 4395 0.03% 27 4407 0.03% 28 4486 0.03% 29 4269 0.03% 30 4514 0.03% 31 4575 0.03% 32 4635 0.03% 33 4618 0.03% 34 4746 0.03% 35 4958 0.03% 36 4919 0.03% 37 4945 0.03% 38 5198 0.03% 39 5082 0.03% 40 4996 0.03% 41 5068 0.03% 42 5084 0.03% 43 5231 0.03% 44 5360 0.03% 45 5954 0.04% 46 5947 0.04% 47 6097 0.04% 48 6374 0.04% 49 6483 0.04% 50 6582 0.04% 51 6826 0.04% 52 6833 0.04% 53 7058 0.04% 54 7371 0.04% 55 7153 0.04% 56 7587 0.04% 57 7110 0.04% 58 7253 0.04% 59 7354 0.04% 60 7461 0.04% 61 7411 0.04% 62 7739 0.05% 63 7520 0.04% 64 7691 0.05% 65 8197 0.05% 66 8172 0.05% 67 8170 0.05% 68 8457 0.05% 69 8136 0.05% 70 8474 0.05% 71 8933 0.05% 72 9339 0.06% 73 9248 0.05% 74 9261 0.05% 75 9635 0.06% 76 6919 0.04% 77 7684 0.05% 78 8814 0.05% 79 9367 0.06% 80 9704 0.06% 81 10101 0.06% 82 10610 0.06% 83 11249 0.07% 84 11708 0.07% 85 12214 0.07% 86 13010 0.08% 87 14000 0.08% 88 14341 0.08% 89 16021 0.09% 90 17160 0.10% 91 19218 0.11% 92 22344 0.13% 93 25314 0.15% 94 28679 0.17% 95 33437 0.20% 96 39555 0.23% 97 49340 0.29% 98 57399 0.34% 99 68120 0.40% 100 16088960 94.94% 16947095 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=20.98 fanout-score-rank=15 prefix-density=0.15 prefix-fanout=18.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=314.13 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=27.9 sequence=TTCTTCTTCTTC Started job on | Feb 11 05:43:17 Started mapping on | Feb 11 05:43:40 Finished on | Feb 11 07:20:29 Mapping speed, Million of reads per hour | 10.50 Number of input reads | 16947095 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 16326824 Uniquely mapped reads % | 96.34% Average mapped length | 98.63 Number of splices: Total | 4757024 Number of splices: Annotated (sjdb) | 4665360 Number of splices: GT/AG | 4683000 Number of splices: GC/AG | 61226 Number of splices: AT/AC | 4890 Number of splices: Non-canonical | 7908 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.13 Insertion rate per base | 0.02% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 398517 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 131968 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 221754 221754 221754 N_multimapping 398517 398517 398517 N_noFeature 733959 8477042 8477847 N_ambiguous 162761 28287 28854 UnstrandedReadsAssigned:15430104 PositiveStrandReadsAssigned:7821495 NegativeStrandReadsAssigned:7820123 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207831 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207831-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,947,095 reads, 15,836,273 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR3207831.ke.tsv 34699 SRR3207831.se.tsv 87100 total ==> SRR3207831.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 802 37.1795 Potri.005G024800.1.v4.1 1035 936 177 16.8229 Potri.004G059700.1.v4.1 961 862 24 2.4769 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 321.065 10.0431 Potri.016G087400.1.v4.1 270 171 666 346.484 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 65 3.45432 Potri.012G127500.1.v4.1 977 878 4153 420.796 ==> SRR3207831.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1462 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR3207831 completed mapping pipeline successfully