Starting /dee2/code/volunteer_pipeline.sh SRR3207832 current disk space = 3055143727104 free memory = 1569276264 SRR3207832 SRAfilesize eb532bc175072066d42336c956a00d97 SRR3207832.sra SRR3207832.sra file validated SRR3207832 is single end SRR3207832 is conventional basespace SRR3207832 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207832_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70475 34.0 33.0 34.0 31.0 34.0 2 33.1215 34.0 34.0 34.0 31.0 34.0 3 33.378 34.0 34.0 34.0 31.0 34.0 4 36.64225 37.0 37.0 37.0 35.0 37.0 5 36.63525 37.0 37.0 37.0 35.0 37.0 6 36.65075 37.0 37.0 37.0 35.0 37.0 7 36.64275 37.0 37.0 37.0 35.0 37.0 8 36.577 37.0 37.0 37.0 35.0 37.0 9 38.49575 39.0 39.0 39.0 37.0 39.0 10-11 38.556125 39.0 39.0 39.0 38.0 39.0 12-13 38.50575 39.0 39.0 39.0 37.5 39.0 14-15 40.180375 41.0 40.0 41.0 38.0 41.0 16-17 40.223 41.0 40.0 41.0 38.5 41.0 18-19 40.214625 41.0 40.0 41.0 39.0 41.0 20-21 40.20725 41.0 40.0 41.0 39.0 41.0 22-23 40.17375 41.0 40.0 41.0 38.5 41.0 24-25 39.977375 41.0 40.0 41.0 38.0 41.0 26-27 39.914375 41.0 40.0 41.0 38.0 41.0 28-29 39.826625 41.0 40.0 41.0 38.0 41.0 30-31 39.855000000000004 41.0 40.0 41.0 38.0 41.0 32-33 39.835499999999996 41.0 40.0 41.0 38.0 41.0 34-35 39.75975 41.0 40.0 41.0 38.0 41.0 36-37 39.729749999999996 41.0 40.0 41.0 38.0 41.0 38-39 39.555625 41.0 40.0 41.0 37.0 41.0 40-41 39.56375 41.0 40.0 41.0 37.0 41.0 42-43 39.469750000000005 41.0 40.0 41.0 37.0 41.0 44-45 39.437375 41.0 40.0 41.0 37.0 41.0 46-47 39.415 41.0 40.0 41.0 37.0 41.0 48-49 39.366125 41.0 40.0 41.0 37.0 41.0 50-51 39.21125 41.0 39.0 41.0 36.0 41.0 52-53 39.142250000000004 41.0 39.0 41.0 36.0 41.0 54-55 38.989875 40.5 39.0 41.0 35.0 41.0 56-57 39.067 41.0 39.0 41.0 35.0 41.0 58-59 39.01 41.0 39.0 41.0 35.0 41.0 60-61 38.765875 41.0 38.0 41.0 35.0 41.0 62-63 38.581875 40.0 37.5 41.0 35.0 41.0 64-65 38.254875 40.0 37.0 41.0 35.0 41.0 66-67 37.98425 39.0 36.5 41.0 35.0 41.0 68-69 37.580875 39.0 36.0 41.0 35.0 41.0 70-71 37.121375 38.0 35.5 40.0 34.0 41.0 72-73 36.687 37.0 35.0 39.0 34.0 41.0 74-75 36.266625000000005 37.0 35.0 39.0 34.0 40.5 76-77 34.567125000000004 35.5 33.5 36.5 31.0 39.0 78-79 35.352000000000004 36.0 35.0 37.0 33.0 39.0 80-81 35.109375 35.0 35.0 37.0 33.0 39.0 82-83 34.857749999999996 35.0 35.0 36.5 33.5 37.0 84-85 34.519375 35.0 35.0 36.0 33.0 37.0 86-87 34.210499999999996 35.0 35.0 36.0 33.0 36.5 88-89 34.1415 35.0 35.0 35.0 33.0 36.0 90-91 33.945125000000004 35.0 35.0 35.0 32.5 36.0 92-93 33.78725 35.0 35.0 35.0 32.5 36.0 94-95 33.756375 35.0 35.0 35.0 32.5 36.0 96-97 33.676874999999995 35.0 35.0 35.0 32.5 35.5 98-99 33.593625 35.0 35.0 35.0 32.5 35.0 100 33.473 35.0 35.0 35.0 32.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 3.0 11 1.0 12 0.0 13 2.0 14 1.0 15 2.0 16 4.0 17 5.0 18 4.0 19 3.0 20 4.0 21 3.0 22 3.0 23 4.0 24 4.0 25 10.0 26 4.0 27 13.0 28 14.0 29 23.0 30 15.0 31 32.0 32 32.0 33 45.0 34 81.0 35 120.0 36 232.0 37 772.0 38 1947.0 39 615.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.614500893540974 14.322185345928007 15.547612969109013 40.515700791422006 2 21.05 22.55 35.85 20.549999999999997 3 22.825 24.375 27.175 25.624999999999996 4 25.95 31.924999999999997 19.375 22.75 5 24.625 36.425000000000004 21.175 17.775 6 18.8 37.525 25.074999999999996 18.6 7 17.224999999999998 19.275000000000002 43.8 19.7 8 19.5 25.124999999999996 29.15 26.224999999999998 9 19.75 24.175 31.275 24.8 10-11 22.425 33.9625 22.575 21.0375 12-13 20.4875 26.5375 29.549999999999997 23.425 14-15 21.462500000000002 27.500000000000004 28.249999999999996 22.787499999999998 16-17 22.112499999999997 28.875 27.462500000000002 21.55 18-19 21.9625 28.65 27.275 22.112499999999997 20-21 22.0625 28.525 27.737499999999997 21.675 22-23 21.3625 29.1875 27.1125 22.3375 24-25 21.337500000000002 28.199999999999996 28.725 21.7375 26-27 21.725 29.312500000000004 27.150000000000002 21.8125 28-29 21.55 28.1875 27.500000000000004 22.7625 30-31 21.212500000000002 28.212500000000002 28.0875 22.4875 32-33 21.7375 28.3125 28.4125 21.5375 34-35 21.762500000000003 28.4 26.900000000000002 22.9375 36-37 21.675 28.462500000000002 28.037499999999998 21.825 38-39 21.2 28.999999999999996 27.425 22.375 40-41 22.325 27.575 27.500000000000004 22.6 42-43 21.349999999999998 28.012500000000003 28.15 22.4875 44-45 22.1375 27.55 27.950000000000003 22.3625 46-47 21.625 28.9 27.700000000000003 21.775 48-49 21.7 27.8625 28.7 21.7375 50-51 21.6125 28.487499999999997 27.987499999999997 21.912499999999998 52-53 22.525000000000002 28.6625 27.2625 21.55 54-55 21.5375 28.849999999999998 27.3375 22.275 56-57 22.8 28.225 27.725 21.25 58-59 22.0875 28.199999999999996 27.762500000000003 21.95 60-61 21.3875 28.15 27.8625 22.6 62-63 21.425 28.525 27.6875 22.3625 64-65 22.400000000000002 28.1125 28.075 21.4125 66-67 21.675 28.175 28.1375 22.0125 68-69 21.95 28.5875 28.4375 21.025 70-71 22.440305038129765 28.253531691461433 27.378422302787847 21.927740967620952 72-73 22.175 28.275 27.575 21.975 74-75 21.637500000000003 28.1375 28.525 21.7 76-77 22.277784723090384 28.82860357544693 27.87848481060132 21.015126890861357 78-79 21.5375 27.35 28.799999999999997 22.3125 80-81 22.0625 27.8375 28.9 21.2 82-83 22.875 27.55 27.9375 21.637500000000003 84-85 21.65 28.625 28.175 21.55 86-87 22.640330041255158 27.57844730591324 29.11613951743968 20.665083135391924 88-89 21.590198774846854 27.740967620952617 28.26603325415677 22.402800350043755 90-91 22.175 27.762500000000003 27.675 22.3875 92-93 23.0 27.85 27.0875 22.0625 94-95 21.875 28.749999999999996 28.212500000000002 21.1625 96-97 22.025 28.037499999999998 28.175 21.762500000000003 98-99 22.1 28.1625 28.262500000000003 21.475 100 23.075000000000003 28.7 26.450000000000003 21.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 3.0 25 3.5 26 2.0 27 3.0 28 4.5 29 8.0 30 17.0 31 29.0 32 38.5 33 42.0 34 54.0 35 69.5 36 90.0 37 119.0 38 132.0 39 166.0 40 211.5 41 240.0 42 256.5 43 256.5 44 257.0 45 271.5 46 275.5 47 239.5 48 222.0 49 205.5 50 170.0 51 154.0 52 125.0 53 86.0 54 60.5 55 47.5 56 32.0 57 18.5 58 17.0 59 14.0 60 10.0 61 7.0 62 6.0 63 6.5 64 7.0 65 5.5 66 3.0 67 1.5 68 0.5 69 2.0 70 2.5 71 1.5 72 1.0 73 2.0 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0125 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.874749498998 99.675 2 0.1002004008016032 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0250501002004008 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 5 0.125 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478656 spots for SRR3207832.sra Written 1478656 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra Read 1478639 spots for SRR3207832.sra Written 1478639 spots for SRR3207832.sra SRR ids: ['SRR3207832.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4oa90o1v SRR3207832.sra spots: 29572797 blocks: [[1, 1478639], [1478640, 2957278], [2957279, 4435917], [4435918, 5914556], [5914557, 7393195], [7393196, 8871834], [8871835, 10350473], [10350474, 11829112], [11829113, 13307751], [13307752, 14786390], [14786391, 16265029], [16265030, 17743668], [17743669, 19222307], [19222308, 20700946], [20700947, 22179585], [22179586, 23658224], [23658225, 25136863], [25136864, 26615502], [26615503, 28094141], [28094142, 29572797]] SRR3207832 file size 7701197 SRR3207832 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207832 SRR3207832_1.fastq Input file: SRR3207832_1.fastq trimmed: SRR3207832-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 05:53:41 2025 >> started Tue Feb 11 06:00:40 2025 >> done (418.686s) 29572797 reads processed; of these: 6025 ( 0.02%) short reads filtered out after trimming by size control 48310 ( 0.16%) empty reads filtered out after trimming by size control 29518462 (99.82%) reads available; of these: 1327535 ( 4.50%) trimmed reads available after processing 28190927 (95.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 582 0.00% 19 679 0.00% 20 829 0.00% 21 1058 0.00% 22 1404 0.00% 23 2007 0.01% 24 2751 0.01% 25 3456 0.01% 26 3468 0.01% 27 3570 0.01% 28 3753 0.01% 29 4070 0.01% 30 4410 0.01% 31 4514 0.02% 32 4803 0.02% 33 4978 0.02% 34 5404 0.02% 35 5723 0.02% 36 5975 0.02% 37 6008 0.02% 38 6275 0.02% 39 6689 0.02% 40 7075 0.02% 41 7305 0.02% 42 7635 0.03% 43 8287 0.03% 44 8745 0.03% 45 8677 0.03% 46 8993 0.03% 47 9474 0.03% 48 9880 0.03% 49 10107 0.03% 50 10144 0.03% 51 10398 0.04% 52 10675 0.04% 53 10648 0.04% 54 11006 0.04% 55 10668 0.04% 56 11240 0.04% 57 11431 0.04% 58 11761 0.04% 59 11758 0.04% 60 11937 0.04% 61 12284 0.04% 62 12545 0.04% 63 12843 0.04% 64 13501 0.05% 65 13228 0.04% 66 13572 0.05% 67 14371 0.05% 68 14926 0.05% 69 15315 0.05% 70 15814 0.05% 71 16138 0.05% 72 16585 0.06% 73 17556 0.06% 74 18207 0.06% 75 19412 0.07% 76 9536 0.03% 77 11292 0.04% 78 13382 0.05% 79 14819 0.05% 80 16334 0.06% 81 16626 0.06% 82 18062 0.06% 83 19775 0.07% 84 20309 0.07% 85 21776 0.07% 86 22943 0.08% 87 25425 0.09% 88 27703 0.09% 89 29162 0.10% 90 31702 0.11% 91 34428 0.12% 92 38263 0.13% 93 41656 0.14% 94 48016 0.16% 95 53932 0.18% 96 61731 0.21% 97 70387 0.24% 98 78595 0.27% 99 85134 0.29% 100 28190927 95.50% 29518462 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=41.27 fanout-score-rank=6 prefix-density=0.27 prefix-fanout=30.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=6 fanout-score=195.73 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=25.4 sequence=AAGAAGAAGAAA Started job on | Feb 11 06:21:53 Started mapping on | Feb 11 06:22:21 Finished on | Feb 11 07:33:16 Mapping speed, Million of reads per hour | 24.97 Number of input reads | 29518462 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 28314029 Uniquely mapped reads % | 95.92% Average mapped length | 98.68 Number of splices: Total | 8021677 Number of splices: Annotated (sjdb) | 7863547 Number of splices: GT/AG | 7894566 Number of splices: GC/AG | 103689 Number of splices: AT/AC | 9065 Number of splices: Non-canonical | 14357 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 703918 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 194235 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.03% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 500515 500515 500515 N_multimapping 703918 703918 703918 N_noFeature 1203264 14596159 14721878 N_ambiguous 300202 50687 50739 UnstrandedReadsAssigned:26810563 PositiveStrandReadsAssigned:13667183 NegativeStrandReadsAssigned:13541412 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207832 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207832-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,518,462 reads, 27,586,508 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR3207832.ke.tsv 34699 SRR3207832.se.tsv 87100 total ==> SRR3207832.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1357 36.6971 Potri.005G024800.1.v4.1 1035 936 616 34.1532 Potri.004G059700.1.v4.1 961 862 38 2.28772 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 547.823 9.99626 Potri.016G087400.1.v4.1 270 171 1142 346.575 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 104 3.22407 Potri.012G127500.1.v4.1 977 878 4005 236.72 ==> SRR3207832.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3472 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 551 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 31 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207832 completed mapping pipeline successfully