Starting /dee2/code/volunteer_pipeline.sh SRR3207833 current disk space = 3054935695360 free memory = 1503645180 SRR3207833 SRAfilesize 6743f1ea6b9c0fe3846875f991af285d SRR3207833.sra SRR3207833.sra file validated SRR3207833 is single end SRR3207833 is conventional basespace SRR3207833 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207833_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84575 34.0 33.0 34.0 31.0 34.0 2 33.24675 34.0 34.0 34.0 31.0 34.0 3 33.474 34.0 34.0 34.0 31.0 34.0 4 36.6645 37.0 37.0 37.0 35.0 37.0 5 36.6905 37.0 37.0 37.0 35.0 37.0 6 36.683 37.0 37.0 37.0 36.0 37.0 7 36.69675 37.0 37.0 37.0 36.0 37.0 8 36.64975 37.0 37.0 37.0 35.0 37.0 9 38.551 39.0 39.0 39.0 38.0 39.0 10-11 38.624 39.0 39.0 39.0 38.0 39.0 12-13 38.57525 39.0 39.0 39.0 38.0 39.0 14-15 40.274625 41.0 40.5 41.0 39.0 41.0 16-17 40.288 41.0 40.5 41.0 39.0 41.0 18-19 40.311125 41.0 40.0 41.0 39.0 41.0 20-21 40.2965 41.0 40.0 41.0 39.0 41.0 22-23 40.226875 41.0 40.0 41.0 39.0 41.0 24-25 40.090625 41.0 40.0 41.0 38.5 41.0 26-27 39.968999999999994 41.0 40.0 41.0 38.0 41.0 28-29 39.94175 41.0 40.0 41.0 38.0 41.0 30-31 39.965 41.0 40.0 41.0 38.0 41.0 32-33 39.82425 41.0 40.0 41.0 38.0 41.0 34-35 39.848749999999995 41.0 40.0 41.0 38.0 41.0 36-37 39.7885 41.0 40.0 41.0 38.0 41.0 38-39 39.66625 41.0 40.0 41.0 38.0 41.0 40-41 39.5895 41.0 40.0 41.0 37.5 41.0 42-43 39.517875000000004 41.0 40.0 41.0 37.5 41.0 44-45 39.472875 41.0 40.0 41.0 37.0 41.0 46-47 39.42225 41.0 40.0 41.0 37.0 41.0 48-49 39.338499999999996 41.0 39.5 41.0 37.0 41.0 50-51 39.224000000000004 41.0 39.0 41.0 36.5 41.0 52-53 39.119 41.0 39.0 41.0 36.0 41.0 54-55 39.039500000000004 41.0 39.0 41.0 35.5 41.0 56-57 39.124375 41.0 39.0 41.0 35.5 41.0 58-59 39.045 41.0 39.0 41.0 35.0 41.0 60-61 38.853625 40.5 38.5 41.0 35.0 41.0 62-63 38.6225 40.0 37.5 41.0 35.0 41.0 64-65 38.218 39.5 37.0 41.0 35.0 41.0 66-67 37.934375 39.0 36.5 41.0 35.0 41.0 68-69 37.519625 39.0 36.0 41.0 35.0 41.0 70-71 37.048125 38.0 35.5 40.0 34.0 41.0 72-73 36.673249999999996 37.0 35.0 39.0 34.0 41.0 74-75 36.230875 37.0 35.0 39.0 34.0 41.0 76-77 34.511875 35.0 33.5 36.5 31.0 39.0 78-79 35.33775 36.0 35.0 37.0 33.0 39.0 80-81 35.055375 35.0 35.0 37.0 33.5 39.0 82-83 34.811625 35.0 35.0 36.5 33.0 37.0 84-85 34.518125 35.0 35.0 36.0 33.0 37.0 86-87 34.221000000000004 35.0 35.0 36.0 33.0 37.0 88-89 34.079 35.0 35.0 35.5 33.0 36.0 90-91 33.935249999999996 35.0 35.0 35.0 33.0 36.0 92-93 33.82625 35.0 35.0 35.0 33.0 36.0 94-95 33.800749999999994 35.0 35.0 35.0 33.0 36.0 96-97 33.74725 35.0 35.0 35.0 33.0 36.0 98-99 33.643125 35.0 35.0 35.0 33.0 35.0 100 33.65175 35.0 35.0 35.0 33.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 2.0 11 2.0 12 1.0 13 2.0 14 6.0 15 2.0 16 1.0 17 2.0 18 4.0 19 1.0 20 3.0 21 3.0 22 4.0 23 6.0 24 5.0 25 11.0 26 7.0 27 13.0 28 16.0 29 20.0 30 16.0 31 30.0 32 28.0 33 42.0 34 60.0 35 91.0 36 245.0 37 780.0 38 1993.0 39 602.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.56165776760742 15.992880752606153 13.323162979913553 43.12229849987287 2 20.5 22.525000000000002 36.05 20.925 3 22.0 26.325 26.075 25.6 4 24.925 31.025000000000002 20.125 23.925 5 23.425 34.4 23.200000000000003 18.975 6 18.325 37.4 25.35 18.925 7 17.224999999999998 20.05 41.125 21.6 8 18.325 25.0 31.424999999999997 25.25 9 19.925 23.7 30.85 25.525 10-11 22.2 32.7625 24.087500000000002 20.95 12-13 20.05 27.725 28.875 23.35 14-15 20.9875 29.012500000000003 27.5625 22.4375 16-17 21.5625 28.95 27.250000000000004 22.237499999999997 18-19 21.912499999999998 28.7375 27.200000000000003 22.15 20-21 22.7375 28.0875 27.275 21.9 22-23 22.275 28.037499999999998 28.075 21.6125 24-25 22.237499999999997 28.6875 27.575 21.5 26-27 21.25 28.549999999999997 27.474999999999998 22.725 28-29 21.2375 28.325 27.787499999999998 22.650000000000002 30-31 21.5 28.712500000000002 28.4 21.3875 32-33 21.637500000000003 28.575 27.9375 21.85 34-35 21.7875 28.8375 27.325 22.05 36-37 21.587500000000002 28.1125 28.6625 21.637500000000003 38-39 20.962500000000002 28.3875 28.237499999999997 22.412499999999998 40-41 21.85 28.475 28.025 21.65 42-43 21.337500000000002 29.425 27.3875 21.85 44-45 21.875 27.250000000000004 27.962500000000002 22.912499999999998 46-47 22.162499999999998 28.199999999999996 28.1 21.5375 48-49 21.5625 27.875 28.6625 21.9 50-51 21.15 28.8375 28.3625 21.65 52-53 21.125 28.975 26.987499999999997 22.912499999999998 54-55 21.2375 28.812500000000004 27.875 22.075 56-57 22.1375 27.762500000000003 27.6 22.5 58-59 22.400000000000002 27.9125 28.3625 21.325 60-61 21.2375 28.6625 28.3875 21.712500000000002 62-63 21.3 28.5875 27.8875 22.225 64-65 21.55 28.425 28.212500000000002 21.8125 66-67 21.1125 28.225 28.000000000000004 22.662499999999998 68-69 21.715214401800225 28.453556694586823 28.316039504938118 21.515189398674835 70-71 21.35800925347005 29.13592597223959 28.185569588595722 21.320495185694636 72-73 21.590198774846854 28.84110513814227 27.890986373296663 21.677709713714215 74-75 21.9625 29.025000000000002 27.800000000000004 21.212500000000002 76-77 21.520570213830187 27.860447667875455 27.810428910841566 22.808553207452796 78-79 21.4375 28.5625 27.900000000000002 22.1 80-81 21.625 28.000000000000004 28.7375 21.637500000000003 82-83 22.0 28.012500000000003 27.85 22.1375 84-85 22.037499999999998 28.0875 28.1125 21.762500000000003 86-87 21.845692134550458 26.860072527197698 28.848318119294735 22.44591721895711 88-89 21.620607727897962 28.123046142303366 28.61072902338377 21.645617106414903 90-91 21.8 27.725 28.325 22.15 92-93 21.965245655706962 28.416052006500813 28.178522315289413 21.440180022502815 94-95 21.6125 28.3125 28.199999999999996 21.875 96-97 21.1875 27.5875 29.062500000000004 22.162499999999998 98-99 21.375 28.212500000000002 28.050000000000004 22.3625 100 21.825 28.375 28.325 21.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 3.0 24 2.0 25 2.0 26 3.5 27 6.0 28 8.0 29 14.5 30 25.5 31 32.5 32 37.5 33 52.0 34 65.0 35 78.0 36 97.5 37 123.5 38 145.0 39 172.0 40 197.0 41 207.0 42 231.0 43 254.0 44 274.5 45 279.0 46 256.0 47 243.5 48 240.0 49 194.0 50 143.5 51 135.0 52 115.0 53 82.5 54 67.5 55 50.0 56 31.0 57 24.0 58 22.5 59 15.0 60 11.0 61 12.5 62 9.5 63 7.0 64 6.0 65 4.5 66 3.0 67 2.5 68 3.0 69 2.5 70 1.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0375 72-73 0.0125 74-75 0.0 76-77 0.0375 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0375 88-89 0.0375 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373194 spots for SRR3207833.sra Written 1373194 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra Read 1373182 spots for SRR3207833.sra Written 1373182 spots for SRR3207833.sra SRR ids: ['SRR3207833.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z0qqo4ob SRR3207833.sra spots: 27463652 blocks: [[1, 1373182], [1373183, 2746364], [2746365, 4119546], [4119547, 5492728], [5492729, 6865910], [6865911, 8239092], [8239093, 9612274], [9612275, 10985456], [10985457, 12358638], [12358639, 13731820], [13731821, 15105002], [15105003, 16478184], [16478185, 17851366], [17851367, 19224548], [19224549, 20597730], [20597731, 21970912], [21970913, 23344094], [23344095, 24717276], [24717277, 26090458], [26090459, 27463652]] SRR3207833 file size 7151150 SRR3207833 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207833 SRR3207833_1.fastq Input file: SRR3207833_1.fastq trimmed: SRR3207833-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 06:14:15 2025 >> started Tue Feb 11 06:31:43 2025 >> done (1047.624s) 27463652 reads processed; of these: 6622 ( 0.02%) short reads filtered out after trimming by size control 24874 ( 0.09%) empty reads filtered out after trimming by size control 27432156 (99.89%) reads available; of these: 1284990 ( 4.68%) trimmed reads available after processing 26147166 (95.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 855 0.00% 19 1005 0.00% 20 1103 0.00% 21 1519 0.01% 22 1936 0.01% 23 2442 0.01% 24 3332 0.01% 25 4033 0.01% 26 4146 0.02% 27 4225 0.02% 28 4407 0.02% 29 4644 0.02% 30 4877 0.02% 31 5036 0.02% 32 5413 0.02% 33 5486 0.02% 34 5949 0.02% 35 6183 0.02% 36 6310 0.02% 37 6669 0.02% 38 7008 0.03% 39 7302 0.03% 40 7290 0.03% 41 7779 0.03% 42 7973 0.03% 43 8528 0.03% 44 9088 0.03% 45 9284 0.03% 46 9407 0.03% 47 9830 0.04% 48 10135 0.04% 49 10519 0.04% 50 10519 0.04% 51 10359 0.04% 52 10688 0.04% 53 10837 0.04% 54 10973 0.04% 55 10729 0.04% 56 10810 0.04% 57 11281 0.04% 58 11663 0.04% 59 11797 0.04% 60 12002 0.04% 61 12316 0.04% 62 12350 0.05% 63 12912 0.05% 64 13258 0.05% 65 13129 0.05% 66 13703 0.05% 67 14187 0.05% 68 14598 0.05% 69 14403 0.05% 70 15120 0.06% 71 15385 0.06% 72 15969 0.06% 73 16814 0.06% 74 17489 0.06% 75 18410 0.07% 76 9354 0.03% 77 10927 0.04% 78 13065 0.05% 79 14142 0.05% 80 15546 0.06% 81 16196 0.06% 82 16942 0.06% 83 18798 0.07% 84 19457 0.07% 85 20389 0.07% 86 21810 0.08% 87 24138 0.09% 88 25752 0.09% 89 27160 0.10% 90 29600 0.11% 91 32060 0.12% 92 35725 0.13% 93 39081 0.14% 94 44071 0.16% 95 50676 0.18% 96 57587 0.21% 97 65410 0.24% 98 72829 0.27% 99 78861 0.29% 100 26147166 95.32% 27432156 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=28.60 fanout-score-rank=12 prefix-density=0.21 prefix-fanout=24.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=344.68 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=29.7 sequence=TTCTTCTTCTTC Started job on | Feb 11 06:40:26 Started mapping on | Feb 11 06:40:35 Finished on | Feb 11 07:33:15 Mapping speed, Million of reads per hour | 31.25 Number of input reads | 27432156 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 25718719 Uniquely mapped reads % | 93.75% Average mapped length | 98.13 Number of splices: Total | 7043185 Number of splices: Annotated (sjdb) | 6893842 Number of splices: GT/AG | 6926253 Number of splices: GC/AG | 91914 Number of splices: AT/AC | 7886 Number of splices: Non-canonical | 17132 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 1.97 Insertion rate per base | 0.02% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 672158 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 168142 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.17% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1041279 1041279 1041279 N_multimapping 672158 672158 672158 N_noFeature 1195493 13465704 13256660 N_ambiguous 283661 45888 46447 UnstrandedReadsAssigned:24239565 PositiveStrandReadsAssigned:12207127 NegativeStrandReadsAssigned:12415612 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207833 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207833-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,432,156 reads, 25,124,357 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,275 rounds 52401 SRR3207833.ke.tsv 34699 SRR3207833.se.tsv 87100 total ==> SRR3207833.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1114 32.7734 Potri.005G024800.1.v4.1 1035 936 522 31.4852 Potri.004G059700.1.v4.1 961 862 46 3.01274 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 563.295 11.182 Potri.016G087400.1.v4.1 270 171 1061 350.293 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 99 3.33881 Potri.012G127500.1.v4.1 977 878 4509 289.933 ==> SRR3207833.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3203 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 492 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 49 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207833 completed mapping pipeline successfully