Starting /dee2/code/volunteer_pipeline.sh SRR3207834 current disk space = 3054897455104 free memory = 1562079900 SRR3207834 SRAfilesize c00b78da1582e1c9ba8fcfb028736fbd SRR3207834.sra SRR3207834.sra file validated SRR3207834 is single end SRR3207834 is conventional basespace SRR3207834 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207834_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98175 34.0 33.0 34.0 31.0 34.0 2 33.32775 34.0 34.0 34.0 31.0 34.0 3 33.54325 34.0 34.0 34.0 31.0 34.0 4 36.7205 37.0 37.0 37.0 37.0 37.0 5 36.62525 37.0 37.0 37.0 35.0 37.0 6 36.7025 37.0 37.0 37.0 36.0 37.0 7 36.52925 37.0 37.0 37.0 35.0 37.0 8 36.65125 37.0 37.0 37.0 35.0 37.0 9 38.5935 39.0 39.0 39.0 38.0 39.0 10-11 38.620999999999995 39.0 39.0 39.0 38.0 39.0 12-13 38.589625 39.0 39.0 39.0 38.0 39.0 14-15 40.335750000000004 41.0 40.5 41.0 39.0 41.0 16-17 40.30775 41.0 40.0 41.0 39.0 41.0 18-19 40.344 41.0 40.0 41.0 39.0 41.0 20-21 40.32875 41.0 40.0 41.0 39.0 41.0 22-23 40.22525 41.0 40.0 41.0 39.0 41.0 24-25 40.11725 41.0 40.0 41.0 38.0 41.0 26-27 39.884375000000006 41.0 40.0 41.0 38.0 41.0 28-29 39.9835 41.0 40.0 41.0 38.0 41.0 30-31 39.832499999999996 41.0 40.0 41.0 38.0 41.0 32-33 39.884874999999994 41.0 40.0 41.0 38.0 41.0 34-35 39.836124999999996 41.0 40.0 41.0 38.0 41.0 36-37 39.781000000000006 41.0 40.0 41.0 38.0 41.0 38-39 39.663875 41.0 40.0 41.0 38.0 41.0 40-41 39.605875 41.0 40.0 41.0 37.5 41.0 42-43 39.4795 41.0 40.0 41.0 37.0 41.0 44-45 39.502375 41.0 40.0 41.0 37.0 41.0 46-47 39.384375000000006 41.0 40.0 41.0 36.5 41.0 48-49 39.325625 41.0 39.5 41.0 36.5 41.0 50-51 39.246375 41.0 39.0 41.0 36.0 41.0 52-53 39.1005 41.0 39.0 41.0 35.5 41.0 54-55 38.91025 40.0 39.0 41.0 35.0 41.0 56-57 38.98925 41.0 39.0 41.0 35.0 41.0 58-59 38.997625 41.0 39.0 41.0 35.0 41.0 60-61 38.878875 40.5 38.5 41.0 35.0 41.0 62-63 38.559 40.0 37.5 41.0 35.0 41.0 64-65 38.337875 40.0 37.0 41.0 35.0 41.0 66-67 37.978125 39.0 36.5 41.0 35.0 41.0 68-69 37.581125 39.0 36.0 41.0 34.5 41.0 70-71 37.141 38.0 35.5 40.5 34.5 41.0 72-73 36.50125 37.0 35.0 39.0 34.0 41.0 74-75 35.97325 37.0 35.0 39.0 33.5 41.0 76-77 34.108125 34.5 33.0 36.5 30.0 39.0 78-79 35.016125 36.0 35.0 37.0 32.5 39.0 80-81 34.878625 35.0 35.0 37.0 33.0 39.0 82-83 34.628625 35.0 35.0 36.5 33.0 37.0 84-85 34.4175 35.0 35.0 36.0 33.0 37.0 86-87 34.152625 35.0 35.0 36.0 33.0 37.0 88-89 33.893625 35.0 35.0 35.5 32.0 36.0 90-91 33.714749999999995 35.0 35.0 35.0 32.0 36.0 92-93 33.627624999999995 35.0 35.0 35.0 32.0 36.0 94-95 33.509249999999994 35.0 35.0 35.0 32.0 36.0 96-97 33.478750000000005 35.0 35.0 35.0 32.5 36.0 98-99 33.318375 35.0 35.0 35.0 32.0 35.5 100 32.8185 35.0 34.0 35.0 30.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 2.0 13 3.0 14 4.0 15 1.0 16 1.0 17 2.0 18 4.0 19 6.0 20 3.0 21 4.0 22 5.0 23 2.0 24 8.0 25 8.0 26 12.0 27 17.0 28 19.0 29 17.0 30 26.0 31 28.0 32 28.0 33 62.0 34 71.0 35 107.0 36 256.0 37 756.0 38 1926.0 39 619.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.719959524411838 16.721477358967874 20.8955223880597 43.66304072856059 2 20.075000000000003 25.25 34.675 20.0 3 22.975 28.349999999999998 25.05 23.625 4 22.725 32.925 21.15 23.200000000000003 5 23.775 34.375 24.65 17.2 6 19.0 38.15 23.025000000000002 19.825 7 16.400000000000002 18.875 42.675000000000004 22.05 8 19.925 23.674999999999997 29.65 26.75 9 21.15 23.0 31.674999999999997 24.175 10-11 22.9375 32.8125 23.0 21.25 12-13 21.05 25.837500000000002 29.4375 23.674999999999997 14-15 21.45 27.3625 28.599999999999998 22.5875 16-17 20.8875 27.8625 28.6125 22.6375 18-19 21.099999999999998 28.287499999999998 28.000000000000004 22.6125 20-21 21.75 28.812500000000004 27.737499999999997 21.7 22-23 21.25 28.5625 27.150000000000002 23.0375 24-25 20.837500000000002 29.2375 27.287499999999998 22.6375 26-27 20.5125 29.099999999999998 28.075 22.3125 28-29 20.7125 28.975 28.3375 21.975 30-31 21.8625 28.475 27.575 22.0875 32-33 21.925 28.5625 27.2625 22.25 34-35 21.05 28.050000000000004 28.512500000000003 22.3875 36-37 21.375 28.7375 27.462500000000002 22.425 38-39 21.2875 28.812500000000004 27.525 22.375 40-41 20.974999999999998 29.25 27.85 21.925 42-43 21.875 28.249999999999996 27.825 22.05 44-45 21.675 28.3625 28.487499999999997 21.475 46-47 22.5875 28.487499999999997 27.3875 21.5375 48-49 21.637500000000003 28.037499999999998 28.537499999999998 21.7875 50-51 21.8875 28.287499999999998 28.0625 21.762500000000003 52-53 20.837500000000002 27.9375 28.075 23.150000000000002 54-55 21.1625 28.65 28.262500000000003 21.925 56-57 21.2375 27.55 28.375 22.8375 58-59 21.8125 28.3625 27.875 21.95 60-61 21.987499999999997 27.8125 28.3625 21.837500000000002 62-63 22.1875 27.8875 28.475 21.45 64-65 21.4 28.050000000000004 28.212500000000002 22.3375 66-67 21.025 28.95 27.9375 22.0875 68-69 21.95 27.800000000000004 28.525 21.725 70-71 21.2 28.425 27.8625 22.5125 72-73 21.2375 28.5625 28.725 21.475 74-75 21.375 27.450000000000003 28.8625 22.3125 76-77 21.775 28.262500000000003 27.437499999999996 22.525000000000002 78-79 20.775 28.925 28.462500000000002 21.837500000000002 80-81 21.525 28.125 28.499999999999996 21.85 82-83 21.9 27.750000000000004 28.487499999999997 21.8625 84-85 21.587500000000002 28.499999999999996 28.6125 21.3 86-87 22.287499999999998 28.762500000000003 27.750000000000004 21.2 88-89 21.45 28.349999999999998 28.1125 22.0875 90-91 21.6125 28.799999999999997 28.075 21.512500000000003 92-93 21.925 28.825 28.4375 20.8125 94-95 21.675 28.749999999999996 28.262500000000003 21.3125 96-97 21.175 28.6625 28.975 21.1875 98-99 22.7 28.3125 27.9375 21.05 100 20.974999999999998 28.299999999999997 29.599999999999998 21.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.5 21 3.0 22 3.0 23 3.0 24 4.0 25 7.5 26 7.0 27 8.0 28 14.5 29 19.5 30 27.0 31 39.0 32 46.5 33 55.5 34 67.5 35 81.5 36 95.5 37 125.5 38 145.0 39 162.5 40 185.5 41 218.5 42 247.0 43 253.5 44 269.5 45 256.0 46 245.5 47 248.0 48 219.5 49 174.0 50 146.5 51 130.0 52 106.0 53 82.5 54 66.0 55 50.0 56 33.5 57 25.5 58 25.0 59 21.0 60 16.0 61 12.0 62 8.0 63 5.5 64 7.0 65 6.5 66 2.0 67 2.5 68 4.0 69 3.0 70 2.0 71 1.5 72 0.5 73 1.0 74 0.5 75 0.5 76 1.5 77 1.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74849094567404 99.15 2 0.2012072434607646 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025150905432595575 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025150905432595575 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTAT 12 0.3 TruSeq Adapter, Index 25 (97% over 44bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTA 6 0.15 TruSeq Adapter, Index 25 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10-11 0.175 0.0 0.0 0.0 0.0 12-13 0.175 0.0 0.0 0.0 0.0 14-15 0.175 0.0 0.0 0.0 0.0 16-17 0.175 0.0 0.0 0.0 0.0 18-19 0.175 0.0 0.0 0.0 0.0 20-21 0.175 0.0 0.0 0.0 0.0 22-23 0.175 0.0 0.0 0.0 0.0 24-25 0.1875 0.0 0.0 0.0 0.0 26-27 0.2 0.0 0.0 0.0 0.0 28-29 0.2 0.0 0.0 0.0 0.0 30-31 0.2 0.0 0.0 0.0 0.0 32-33 0.2 0.0 0.0 0.0 0.0 34-35 0.2 0.0 0.0 0.0 0.0 36-37 0.2 0.0 0.0 0.0 0.0 38-39 0.2 0.0 0.0 0.0 0.0 40-41 0.2 0.0 0.0 0.0 0.0 42-43 0.2 0.0 0.0 0.0 0.0 44-45 0.2 0.0 0.0 0.0 0.0 46-47 0.2 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.2 0.0 0.0 0.0 0.0 54-55 0.2 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365412 spots for SRR3207834.sra Written 1365412 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra Read 1365411 spots for SRR3207834.sra Written 1365411 spots for SRR3207834.sra SRR ids: ['SRR3207834.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ka254cr SRR3207834.sra spots: 27308221 blocks: [[1, 1365411], [1365412, 2730822], [2730823, 4096233], [4096234, 5461644], [5461645, 6827055], [6827056, 8192466], [8192467, 9557877], [9557878, 10923288], [10923289, 12288699], [12288700, 13654110], [13654111, 15019521], [15019522, 16384932], [16384933, 17750343], [17750344, 19115754], [19115755, 20481165], [20481166, 21846576], [21846577, 23211987], [23211988, 24577398], [24577399, 25942809], [25942810, 27308221]] SRR3207834 file size 7110472 SRR3207834 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207834 SRR3207834_1.fastq Input file: SRR3207834_1.fastq trimmed: SRR3207834-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 06:39:21 2025 >> started Tue Feb 11 06:44:36 2025 >> done (315.545s) 27308221 reads processed; of these: 5841 ( 0.02%) short reads filtered out after trimming by size control 158886 ( 0.58%) empty reads filtered out after trimming by size control 27143494 (99.40%) reads available; of these: 1309244 ( 4.82%) trimmed reads available after processing 25834250 (95.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 692 0.00% 19 902 0.00% 20 972 0.00% 21 1219 0.00% 22 1681 0.01% 23 2314 0.01% 24 2985 0.01% 25 3902 0.01% 26 4042 0.01% 27 4160 0.02% 28 4270 0.02% 29 4515 0.02% 30 4665 0.02% 31 4900 0.02% 32 5324 0.02% 33 5534 0.02% 34 6233 0.02% 35 6189 0.02% 36 6495 0.02% 37 6877 0.03% 38 7053 0.03% 39 7655 0.03% 40 7682 0.03% 41 8253 0.03% 42 8577 0.03% 43 9071 0.03% 44 9481 0.03% 45 9692 0.04% 46 9681 0.04% 47 10421 0.04% 48 10435 0.04% 49 10651 0.04% 50 10741 0.04% 51 11619 0.04% 52 11132 0.04% 53 11777 0.04% 54 11589 0.04% 55 11146 0.04% 56 11281 0.04% 57 11617 0.04% 58 12716 0.05% 59 12216 0.05% 60 12898 0.05% 61 12570 0.05% 62 12800 0.05% 63 13222 0.05% 64 13148 0.05% 65 13710 0.05% 66 13916 0.05% 67 14151 0.05% 68 14704 0.05% 69 13986 0.05% 70 15207 0.06% 71 16172 0.06% 72 16738 0.06% 73 17270 0.06% 74 18082 0.07% 75 19040 0.07% 76 9354 0.03% 77 10848 0.04% 78 13195 0.05% 79 14589 0.05% 80 15683 0.06% 81 16481 0.06% 82 17798 0.07% 83 18902 0.07% 84 19596 0.07% 85 20374 0.08% 86 21331 0.08% 87 23226 0.09% 88 25352 0.09% 89 27468 0.10% 90 29221 0.11% 91 32113 0.12% 92 35637 0.13% 93 39209 0.14% 94 45271 0.17% 95 52284 0.19% 96 59114 0.22% 97 68210 0.25% 98 75278 0.28% 99 78739 0.29% 100 25834250 95.18% 27143494 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=13.85 fanout-score-rank=14 prefix-density=0.10 prefix-fanout=13.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTATGCCGTCTTCTGCTTGAAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=16 fanout-score=272.27 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=26.7 sequence=TTCTTCTTCTTT Started job on | Feb 11 07:13:21 Started mapping on | Feb 11 07:13:33 Finished on | Feb 11 07:33:17 Mapping speed, Million of reads per hour | 82.53 Number of input reads | 27143494 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 24068283 Uniquely mapped reads % | 88.67% Average mapped length | 98.59 Number of splices: Total | 6665881 Number of splices: Annotated (sjdb) | 6529652 Number of splices: GT/AG | 6559000 Number of splices: GC/AG | 86295 Number of splices: AT/AC | 6886 Number of splices: Non-canonical | 13700 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.92 Insertion rate per base | 0.01% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 598901 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 432359 % of reads mapped to too many loci | 1.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.52% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2476310 2476310 2476310 N_multimapping 598901 598901 598901 N_noFeature 1295684 12638730 12548308 N_ambiguous 262526 41944 44021 UnstrandedReadsAssigned:22510073 PositiveStrandReadsAssigned:11387609 NegativeStrandReadsAssigned:11475954 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207834 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207834-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,143,494 reads, 23,467,412 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,301 rounds 52401 SRR3207834.ke.tsv 34699 SRR3207834.se.tsv 87100 total ==> SRR3207834.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1156 38.891 Potri.005G024800.1.v4.1 1035 936 186 12.8293 Potri.004G059700.1.v4.1 961 862 37 2.77116 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 383.865 8.71395 Potri.016G087400.1.v4.1 270 171 700 264.283 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 102 3.93379 Potri.012G127500.1.v4.1 977 878 4221 310.375 ==> SRR3207834.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 3128 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 358 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 39 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 7 SRR3207834 completed mapping pipeline successfully