Starting /dee2/code/volunteer_pipeline.sh SRR3207835 current disk space = 3054967607296 free memory = 1562160952 SRR3207835 SRAfilesize bcdf1267f9da3915532ed0fc33333523 SRR3207835.sra SRR3207835.sra file validated SRR3207835 is single end SRR3207835 is conventional basespace SRR3207835 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207835_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70125 34.0 33.0 34.0 31.0 34.0 2 33.1265 34.0 34.0 34.0 31.0 34.0 3 33.409 34.0 34.0 34.0 31.0 34.0 4 36.67425 37.0 37.0 37.0 35.0 37.0 5 36.58925 37.0 37.0 37.0 35.0 37.0 6 36.664 37.0 37.0 37.0 35.0 37.0 7 36.5375 37.0 37.0 37.0 35.0 37.0 8 36.6385 37.0 37.0 37.0 35.0 37.0 9 38.572 39.0 39.0 39.0 38.0 39.0 10-11 38.598875 39.0 39.0 39.0 38.0 39.0 12-13 38.573625 39.0 39.0 39.0 38.0 39.0 14-15 40.315125 41.0 41.0 41.0 39.0 41.0 16-17 40.272875 41.0 40.0 41.0 39.0 41.0 18-19 40.26925 41.0 40.5 41.0 39.0 41.0 20-21 40.26649999999999 41.0 40.0 41.0 39.0 41.0 22-23 40.176375 41.0 40.0 41.0 39.0 41.0 24-25 40.02625 41.0 40.0 41.0 38.0 41.0 26-27 39.908 41.0 40.0 41.0 38.0 41.0 28-29 40.006375000000006 41.0 40.0 41.0 38.0 41.0 30-31 39.767875000000004 41.0 40.0 41.0 38.0 41.0 32-33 39.84975 41.0 40.0 41.0 38.0 41.0 34-35 39.854749999999996 41.0 40.0 41.0 38.0 41.0 36-37 39.778375 41.0 40.0 41.0 38.0 41.0 38-39 39.641000000000005 41.0 40.0 41.0 38.0 41.0 40-41 39.643249999999995 41.0 40.0 41.0 37.5 41.0 42-43 39.469 41.0 40.0 41.0 37.0 41.0 44-45 39.56875 41.0 40.0 41.0 37.0 41.0 46-47 39.5125 41.0 40.0 41.0 37.0 41.0 48-49 39.447625 41.0 40.0 41.0 37.0 41.0 50-51 39.338875 41.0 39.0 41.0 37.0 41.0 52-53 39.16175 41.0 39.0 41.0 36.0 41.0 54-55 38.94525 40.5 39.0 41.0 35.5 41.0 56-57 39.043125 41.0 39.0 41.0 35.0 41.0 58-59 39.041624999999996 41.0 39.0 41.0 35.0 41.0 60-61 38.84462499999999 40.5 38.5 41.0 35.0 41.0 62-63 38.650875 40.0 37.5 41.0 35.0 41.0 64-65 38.3865 40.0 37.0 41.0 35.0 41.0 66-67 38.03975 39.0 36.5 41.0 35.0 41.0 68-69 37.665499999999994 39.0 36.0 41.0 35.0 41.0 70-71 37.26025 38.0 35.5 40.5 34.5 41.0 72-73 36.716 37.0 35.0 39.0 34.0 41.0 74-75 36.195499999999996 37.0 35.0 39.0 34.0 41.0 76-77 34.288250000000005 35.0 33.0 36.5 30.0 39.0 78-79 35.249875 36.0 35.0 37.0 32.5 39.0 80-81 35.107375000000005 35.0 35.0 37.0 34.0 39.0 82-83 34.751999999999995 35.0 35.0 36.5 33.0 37.5 84-85 34.49825 35.0 35.0 36.0 33.0 37.0 86-87 34.285624999999996 35.0 35.0 36.0 33.0 37.0 88-89 34.08775 35.0 35.0 35.5 33.0 36.0 90-91 33.97325 35.0 35.0 35.0 32.5 36.0 92-93 33.8475 35.0 35.0 35.0 32.5 36.0 94-95 33.795625 35.0 35.0 35.0 33.0 36.0 96-97 33.691625 35.0 35.0 35.0 32.5 36.0 98-99 33.60025 35.0 35.0 35.0 33.0 35.5 100 33.20375 35.0 34.0 35.0 31.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 3.0 11 1.0 12 0.0 13 0.0 14 1.0 15 3.0 16 2.0 17 4.0 18 7.0 19 5.0 20 5.0 21 1.0 22 4.0 23 4.0 24 5.0 25 7.0 26 10.0 27 10.0 28 18.0 29 16.0 30 18.0 31 31.0 32 39.0 33 40.0 34 69.0 35 101.0 36 214.0 37 814.0 38 1936.0 39 630.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.072412034676187 15.47679755226925 17.134115247322796 39.316675165731766 2 20.549999999999997 23.7 35.5 20.25 3 22.925 26.974999999999998 26.674999999999997 23.425 4 23.825 31.8 19.900000000000002 24.474999999999998 5 23.43671835917959 35.467733866933465 22.511255627813906 18.584292146073036 6 18.575 38.074999999999996 24.075 19.275000000000002 7 16.725 20.45 43.125 19.7 8 20.025000000000002 24.375 30.425 25.174999999999997 9 20.849999999999998 23.150000000000002 31.85 24.15 10-11 22.3375 34.150000000000006 22.5 21.0125 12-13 20.3875 27.275 29.125 23.2125 14-15 20.7125 27.9125 29.012500000000003 22.3625 16-17 21.762500000000003 29.45 26.887499999999996 21.9 18-19 21.8 29.3375 27.200000000000003 21.6625 20-21 22.237499999999997 28.4375 28.1625 21.1625 22-23 21.325 28.8875 27.737499999999997 22.05 24-25 21.475 28.000000000000004 29.025000000000002 21.5 26-27 21.275 29.25 27.9125 21.5625 28-29 21.912499999999998 28.487499999999997 27.800000000000004 21.8 30-31 21.9375 28.199999999999996 28.000000000000004 21.8625 32-33 21.712500000000002 29.0875 26.875 22.325 34-35 21.587500000000002 28.762500000000003 27.150000000000002 22.5 36-37 21.837500000000002 27.775 28.4125 21.975 38-39 21.087500000000002 28.525 28.050000000000004 22.3375 40-41 20.962500000000002 27.987499999999997 29.3875 21.6625 42-43 21.837500000000002 28.712500000000002 27.900000000000002 21.55 44-45 21.1125 29.062500000000004 28.287499999999998 21.5375 46-47 21.625 27.6 28.4375 22.3375 48-49 20.825 28.275 28.549999999999997 22.35 50-51 22.25 27.575 28.537499999999998 21.637500000000003 52-53 21.3875 28.3375 28.749999999999996 21.525 54-55 22.4375 27.3875 28.15 22.025 56-57 21.1875 29.1625 28.3375 21.3125 58-59 21.6 27.950000000000003 28.299999999999997 22.15 60-61 21.05 27.750000000000004 28.9875 22.2125 62-63 20.7125 28.599999999999998 28.725 21.9625 64-65 21.2875 27.9125 29.3875 21.4125 66-67 22.15 27.737499999999997 28.3875 21.725 68-69 20.8625 28.487499999999997 29.175 21.475 70-71 21.762500000000003 28.262500000000003 28.025 21.95 72-73 21.8 28.799999999999997 28.000000000000004 21.4 74-75 21.837500000000002 28.599999999999998 27.3625 22.2 76-77 21.3 28.775000000000002 28.237499999999997 21.6875 78-79 20.875 28.875 28.375 21.875 80-81 21.587500000000002 28.1875 28.8375 21.3875 82-83 22.35 28.15 28.3125 21.1875 84-85 21.912499999999998 28.425 27.5625 22.1 86-87 21.625 28.037499999999998 28.262500000000003 22.075 88-89 21.1375 28.675 28.1125 22.075 90-91 21.2625 28.875 28.537499999999998 21.325 92-93 21.912499999999998 28.712500000000002 28.1875 21.1875 94-95 22.275 26.9625 29.025000000000002 21.7375 96-97 22.7125 28.0625 27.650000000000002 21.575 98-99 21.7 29.012500000000003 28.525 20.7625 100 22.425 27.975 28.825 20.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 3.0 26 4.0 27 8.0 28 12.5 29 15.0 30 21.5 31 34.5 32 44.0 33 48.0 34 71.5 35 97.5 36 97.5 37 121.0 38 164.0 39 170.5 40 191.0 41 236.5 42 256.5 43 261.0 44 265.5 45 269.5 46 254.5 47 229.0 48 205.5 49 181.5 50 153.5 51 126.5 52 107.0 53 89.5 54 66.5 55 46.0 56 35.0 57 23.0 58 14.0 59 14.5 60 15.0 61 10.0 62 7.0 63 5.0 64 5.0 65 3.0 66 1.5 67 1.5 68 1.5 69 2.0 70 1.5 71 0.5 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82442939553549 99.5 2 0.1254075746175069 0.25 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025081514923501375 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTA 7 0.17500000000000002 TruSeq Adapter, Index 27 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10-11 0.175 0.0 0.0 0.0 0.0 12-13 0.175 0.0 0.0 0.0 0.0 14-15 0.2 0.0 0.0 0.0 0.0 16-17 0.2 0.0 0.0 0.0 0.0 18-19 0.2 0.0 0.0 0.0 0.0 20-21 0.2 0.0 0.0 0.0 0.0 22-23 0.21250000000000002 0.0 0.0 0.0 0.0 24-25 0.225 0.0 0.0 0.0 0.0 26-27 0.225 0.0 0.0 0.0 0.0 28-29 0.225 0.0 0.0 0.0 0.0 30-31 0.225 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.225 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.225 0.0 0.0 0.0 0.0 44-45 0.225 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.225 0.0 0.0 0.0 0.0 58-59 0.225 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.5625 0.0 0.0 0.0 0.0 84-85 0.7125 0.0 0.0 0.0 0.0 86-87 0.8374999999999999 0.0 0.0 0.0 0.0 88 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra Read 1633727 spots for SRR3207835.sra Written 1633727 spots for SRR3207835.sra Read 1633718 spots for SRR3207835.sra Written 1633718 spots for SRR3207835.sra SRR ids: ['SRR3207835.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u9inb8gz SRR3207835.sra spots: 32674369 blocks: [[1, 1633718], [1633719, 3267436], [3267437, 4901154], [4901155, 6534872], [6534873, 8168590], [8168591, 9802308], [9802309, 11436026], [11436027, 13069744], [13069745, 14703462], [14703463, 16337180], [16337181, 17970898], [17970899, 19604616], [19604617, 21238334], [21238335, 22872052], [22872053, 24505770], [24505771, 26139488], [26139489, 27773206], [27773207, 29406924], [29406925, 31040642], [31040643, 32674369]] SRR3207835 file size 8509891 SRR3207835 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207835 SRR3207835_1.fastq Input file: SRR3207835_1.fastq trimmed: SRR3207835-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 06:52:29 2025 >> started Tue Feb 11 07:07:01 2025 >> done (872.241s) 32674369 reads processed; of these: 7662 ( 0.02%) short reads filtered out after trimming by size control 133741 ( 0.41%) empty reads filtered out after trimming by size control 32532966 (99.57%) reads available; of these: 1415995 ( 4.35%) trimmed reads available after processing 31116971 (95.65%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 840 0.00% 19 945 0.00% 20 1060 0.00% 21 1453 0.00% 22 1778 0.01% 23 2572 0.01% 24 3405 0.01% 25 4161 0.01% 26 4369 0.01% 27 4465 0.01% 28 4607 0.01% 29 4761 0.01% 30 5018 0.02% 31 5183 0.02% 32 5552 0.02% 33 5850 0.02% 34 6177 0.02% 35 6438 0.02% 36 6975 0.02% 37 7216 0.02% 38 7326 0.02% 39 7559 0.02% 40 7984 0.02% 41 8382 0.03% 42 8781 0.03% 43 9299 0.03% 44 9723 0.03% 45 9859 0.03% 46 9983 0.03% 47 10437 0.03% 48 10825 0.03% 49 10989 0.03% 50 11322 0.03% 51 11965 0.04% 52 11733 0.04% 53 12125 0.04% 54 12254 0.04% 55 11910 0.04% 56 11945 0.04% 57 12108 0.04% 58 12896 0.04% 59 12923 0.04% 60 13136 0.04% 61 13236 0.04% 62 13649 0.04% 63 14048 0.04% 64 14562 0.04% 65 14894 0.05% 66 15176 0.05% 67 15841 0.05% 68 16088 0.05% 69 14985 0.05% 70 16093 0.05% 71 18577 0.06% 72 18764 0.06% 73 18721 0.06% 74 19448 0.06% 75 20087 0.06% 76 9922 0.03% 77 11780 0.04% 78 13995 0.04% 79 15597 0.05% 80 16831 0.05% 81 17558 0.05% 82 18902 0.06% 83 20726 0.06% 84 21103 0.06% 85 22222 0.07% 86 22891 0.07% 87 24944 0.08% 88 27678 0.09% 89 29889 0.09% 90 32028 0.10% 91 34962 0.11% 92 39293 0.12% 93 43354 0.13% 94 49918 0.15% 95 57530 0.18% 96 65536 0.20% 97 75830 0.23% 98 83332 0.26% 99 87716 0.27% 100 31116971 95.65% 32532966 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=63.45 fanout-score-rank=10 prefix-density=0.97 prefix-fanout=42.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=15 fanout-score=309.71 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=27.9 sequence=TTCTTCTTCTTC Started job on | Feb 11 07:15:56 Started mapping on | Feb 11 07:16:14 Finished on | Feb 11 07:33:17 Mapping speed, Million of reads per hour | 114.49 Number of input reads | 32532966 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 30027824 Uniquely mapped reads % | 92.30% Average mapped length | 98.51 Number of splices: Total | 8020992 Number of splices: Annotated (sjdb) | 7848063 Number of splices: GT/AG | 7886290 Number of splices: GC/AG | 106956 Number of splices: AT/AC | 8703 Number of splices: Non-canonical | 19043 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 1.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 740850 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 208229 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.77% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1764292 1764292 1764292 N_multimapping 740850 740850 740850 N_noFeature 1508396 15634532 15676102 N_ambiguous 337067 55752 56297 UnstrandedReadsAssigned:28182361 PositiveStrandReadsAssigned:14337540 NegativeStrandReadsAssigned:14295425 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207835 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207835-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,532,966 reads, 29,037,131 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR3207835.ke.tsv 34699 SRR3207835.se.tsv 87100 total ==> SRR3207835.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1442 36.5557 Potri.005G024800.1.v4.1 1035 936 321 16.6838 Potri.004G059700.1.v4.1 961 862 42 2.37032 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 494.867 8.46493 Potri.016G087400.1.v4.1 270 171 1167 332.001 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 144 4.18477 Potri.012G127500.1.v4.1 977 878 8123 450.077 ==> SRR3207835.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3600 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 591 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR3207835 completed mapping pipeline successfully