Starting /dee2/code/volunteer_pipeline.sh SRR3207836 current disk space = 3054897455104 free memory = 1496440404 SRR3207836 SRAfilesize 5453e8dd573d7568c44c4e205826a477 SRR3207836.sra SRR3207836.sra file validated SRR3207836 is single end SRR3207836 is conventional basespace SRR3207836 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207836_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.64725 34.0 33.0 34.0 31.0 34.0 2 33.1145 34.0 34.0 34.0 31.0 34.0 3 33.4095 34.0 34.0 34.0 31.0 34.0 4 36.634 37.0 37.0 37.0 35.0 37.0 5 36.678 37.0 37.0 37.0 35.0 37.0 6 36.69275 37.0 37.0 37.0 35.0 37.0 7 36.67425 37.0 37.0 37.0 35.0 37.0 8 36.61325 37.0 37.0 37.0 35.0 37.0 9 38.5125 39.0 39.0 39.0 37.0 39.0 10-11 38.5775 39.0 39.0 39.0 38.0 39.0 12-13 38.575 39.0 39.0 39.0 38.0 39.0 14-15 40.255375 41.0 40.0 41.0 39.0 41.0 16-17 40.263000000000005 41.0 40.0 41.0 39.0 41.0 18-19 40.275 41.0 40.0 41.0 39.0 41.0 20-21 40.258125 41.0 40.0 41.0 39.0 41.0 22-23 40.208875 41.0 40.0 41.0 39.0 41.0 24-25 40.10125 41.0 40.0 41.0 38.0 41.0 26-27 40.0155 41.0 40.0 41.0 38.0 41.0 28-29 39.966125 41.0 40.0 41.0 38.0 41.0 30-31 39.97625 41.0 40.0 41.0 38.0 41.0 32-33 39.8915 41.0 40.0 41.0 38.0 41.0 34-35 39.845749999999995 41.0 40.0 41.0 38.0 41.0 36-37 39.756375000000006 41.0 40.0 41.0 38.0 41.0 38-39 39.59725 41.0 40.0 41.0 37.5 41.0 40-41 39.56675 41.0 40.0 41.0 37.0 41.0 42-43 39.45925 41.0 40.0 41.0 37.0 41.0 44-45 39.45225 41.0 40.0 41.0 37.0 41.0 46-47 39.428625 41.0 40.0 41.0 37.0 41.0 48-49 39.321625 41.0 39.5 41.0 36.5 41.0 50-51 39.26075 41.0 39.0 41.0 36.5 41.0 52-53 39.12350000000001 41.0 39.0 41.0 36.0 41.0 54-55 38.98925 40.5 39.0 41.0 35.0 41.0 56-57 39.010875 41.0 39.0 41.0 35.0 41.0 58-59 38.966750000000005 41.0 39.0 41.0 35.0 41.0 60-61 38.7775 40.5 38.0 41.0 35.0 41.0 62-63 38.594875 40.0 37.5 41.0 35.0 41.0 64-65 38.162625 39.5 37.0 41.0 35.0 41.0 66-67 37.8755 39.0 36.0 41.0 35.0 41.0 68-69 37.497625 39.0 36.0 41.0 34.0 41.0 70-71 37.039125 37.5 35.0 40.0 34.0 41.0 72-73 36.638625000000005 37.0 35.0 39.0 34.0 41.0 74-75 36.207375 36.5 35.0 39.0 34.0 40.5 76-77 34.48625 35.0 33.5 36.5 31.0 39.0 78-79 35.292249999999996 36.0 35.0 37.0 33.0 39.0 80-81 35.050125 35.0 35.0 37.0 33.0 39.0 82-83 34.756625 35.0 35.0 36.0 33.0 37.0 84-85 34.477374999999995 35.0 35.0 36.0 33.0 37.0 86-87 34.243625 35.0 35.0 36.0 33.0 36.5 88-89 34.15325 35.0 35.0 35.0 33.0 36.0 90-91 33.967875 35.0 35.0 35.0 33.0 36.0 92-93 33.845375000000004 35.0 35.0 35.0 33.0 36.0 94-95 33.816874999999996 35.0 35.0 35.0 32.5 36.0 96-97 33.7655 35.0 35.0 35.0 32.0 36.0 98-99 33.679500000000004 35.0 35.0 35.0 33.0 35.0 100 33.565 35.0 35.0 35.0 32.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 2.0 12 2.0 13 1.0 14 5.0 15 4.0 16 3.0 17 2.0 18 2.0 19 2.0 20 1.0 21 4.0 22 4.0 23 4.0 24 6.0 25 6.0 26 5.0 27 8.0 28 10.0 29 16.0 30 27.0 31 26.0 32 36.0 33 57.0 34 57.0 35 114.0 36 242.0 37 810.0 38 1968.0 39 570.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.66120777891505 14.380757420675538 14.227226202661209 43.73080859774821 2 19.925 22.1 35.449999999999996 22.525000000000002 3 21.925 25.174999999999997 26.424999999999997 26.474999999999998 4 25.124999999999996 32.25 19.675 22.95 5 24.625 33.175 23.125 19.075 6 18.95 36.175000000000004 24.825 20.05 7 16.775000000000002 19.650000000000002 41.699999999999996 21.875 8 19.525000000000002 24.775 30.075000000000003 25.624999999999996 9 20.849999999999998 23.125 31.424999999999997 24.6 10-11 22.4875 33.1875 23.075000000000003 21.25 12-13 21.087500000000002 26.737499999999997 29.1125 23.0625 14-15 21.087500000000002 27.6875 29.575000000000003 21.65 16-17 22.025 27.325 27.5875 23.0625 18-19 21.525 28.075 28.375 22.025 20-21 22.175 28.4 27.1 22.325 22-23 21.0375 29.1625 27.462500000000002 22.3375 24-25 22.5 28.1125 27.075 22.3125 26-27 21.6125 28.212500000000002 27.675 22.5 28-29 21.637500000000003 28.4 27.55 22.412499999999998 30-31 22.0875 28.225 26.75 22.9375 32-33 22.3625 28.012500000000003 27.150000000000002 22.475 34-35 22.0 28.725 27.125 22.15 36-37 22.425 28.825 27.1125 21.637500000000003 38-39 21.8875 29.2 26.737499999999997 22.175 40-41 22.4625 27.8875 27.5125 22.1375 42-43 22.9875 28.0625 27.462500000000002 21.4875 44-45 22.1 27.8375 27.8875 22.175 46-47 22.162499999999998 28.275 27.237499999999997 22.325 48-49 21.775 28.262500000000003 27.975 21.987499999999997 50-51 21.9625 27.6875 28.15 22.2 52-53 21.9 28.175 27.8375 22.0875 54-55 21.375 27.85 28.037499999999998 22.7375 56-57 21.1625 28.7375 28.037499999999998 22.0625 58-59 23.0125 27.537499999999998 27.525 21.925 60-61 22.400000000000002 28.3625 27.287499999999998 21.95 62-63 22.112499999999997 28.287499999999998 27.0875 22.5125 64-65 22.125 28.375 27.9375 21.5625 66-67 22.15 28.1625 28.3125 21.375 68-69 22.162499999999998 27.0875 28.125 22.625 70-71 22.690336292036505 27.315914489311165 28.166020752594072 21.827728466058257 72-73 21.987499999999997 27.725 28.225 22.0625 74-75 22.1875 26.737499999999997 29.625 21.45 76-77 21.677709713714215 27.84098012251531 28.253531691461433 22.22777847230904 78-79 21.6875 28.599999999999998 27.525 22.1875 80-81 23.150000000000002 27.0625 27.987499999999997 21.8 82-83 22.6875 28.1625 27.6125 21.5375 84-85 22.7 27.8625 27.8875 21.55 86-87 22.652831603950492 28.128516064508062 28.678584823102888 20.540067508438558 88-89 23.202900362545318 28.066008251031377 27.065883235404424 21.665208151018877 90-91 22.25 28.075 27.625 22.05 92-93 21.85 27.487499999999997 28.65 22.0125 94-95 22.075 27.8375 28.037499999999998 22.05 96-97 22.2 27.950000000000003 27.775 22.075 98-99 22.625 28.299999999999997 27.950000000000003 21.125 100 22.3 28.025 28.075 21.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.5 20 1.0 21 0.0 22 0.5 23 1.0 24 1.0 25 2.0 26 3.5 27 3.5 28 7.0 29 11.5 30 16.0 31 24.5 32 30.0 33 39.5 34 52.5 35 59.5 36 75.0 37 105.0 38 134.0 39 157.5 40 197.5 41 217.5 42 237.0 43 267.5 44 283.5 45 273.5 46 263.0 47 275.5 48 234.5 49 187.0 50 161.5 51 136.0 52 115.5 53 97.5 54 82.0 55 58.0 56 39.5 57 34.0 58 27.5 59 16.0 60 11.0 61 8.5 62 7.5 63 8.0 64 5.0 65 3.5 66 3.0 67 3.0 68 2.5 69 1.5 70 2.0 71 1.5 72 1.5 73 1.0 74 0.5 75 1.0 76 1.5 77 1.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0125 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710761 spots for SRR3207836.sra Written 1710761 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra Read 1710742 spots for SRR3207836.sra Written 1710742 spots for SRR3207836.sra SRR ids: ['SRR3207836.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ci2sq5ts SRR3207836.sra spots: 34214859 blocks: [[1, 1710742], [1710743, 3421484], [3421485, 5132226], [5132227, 6842968], [6842969, 8553710], [8553711, 10264452], [10264453, 11975194], [11975195, 13685936], [13685937, 15396678], [15396679, 17107420], [17107421, 18818162], [18818163, 20528904], [20528905, 22239646], [22239647, 23950388], [23950389, 25661130], [25661131, 27371872], [27371873, 29082614], [29082615, 30793356], [30793357, 32504098], [32504099, 34214859]] SRR3207836 file size 8911730 SRR3207836 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207836 SRR3207836_1.fastq Input file: SRR3207836_1.fastq trimmed: SRR3207836-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 06:53:58 2025 >> started Tue Feb 11 07:02:39 2025 >> done (521.487s) 34214859 reads processed; of these: 7707 ( 0.02%) short reads filtered out after trimming by size control 17580 ( 0.05%) empty reads filtered out after trimming by size control 34189572 (99.93%) reads available; of these: 1579237 ( 4.62%) trimmed reads available after processing 32610335 (95.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 888 0.00% 19 918 0.00% 20 1179 0.00% 21 1443 0.00% 22 1908 0.01% 23 2600 0.01% 24 3451 0.01% 25 4249 0.01% 26 4272 0.01% 27 4569 0.01% 28 4728 0.01% 29 4939 0.01% 30 5286 0.02% 31 5510 0.02% 32 5821 0.02% 33 5941 0.02% 34 6670 0.02% 35 6879 0.02% 36 6974 0.02% 37 7183 0.02% 38 7575 0.02% 39 7955 0.02% 40 8359 0.02% 41 8690 0.03% 42 9070 0.03% 43 10123 0.03% 44 10297 0.03% 45 10556 0.03% 46 11077 0.03% 47 11321 0.03% 48 11721 0.03% 49 12117 0.04% 50 12129 0.04% 51 12225 0.04% 52 12453 0.04% 53 12523 0.04% 54 12936 0.04% 55 12806 0.04% 56 13009 0.04% 57 13341 0.04% 58 13668 0.04% 59 13913 0.04% 60 14099 0.04% 61 14618 0.04% 62 14732 0.04% 63 14976 0.04% 64 15950 0.05% 65 15606 0.05% 66 16110 0.05% 67 16678 0.05% 68 17482 0.05% 69 17213 0.05% 70 18249 0.05% 71 18712 0.05% 72 19711 0.06% 73 20575 0.06% 74 21843 0.06% 75 23306 0.07% 76 11757 0.03% 77 13312 0.04% 78 15960 0.05% 79 17643 0.05% 80 18910 0.06% 81 20095 0.06% 82 21664 0.06% 83 23633 0.07% 84 24157 0.07% 85 25851 0.08% 86 27309 0.08% 87 29973 0.09% 88 32860 0.10% 89 34882 0.10% 90 37421 0.11% 91 40893 0.12% 92 45211 0.13% 93 48980 0.14% 94 57116 0.17% 95 63745 0.19% 96 73605 0.22% 97 84280 0.25% 98 94221 0.28% 99 102627 0.30% 100 32610335 95.38% 34189572 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=4.93 fanout-score-rank=23 prefix-density=0.03 prefix-fanout=4.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=12 fanout-score=183.74 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=24.2 sequence=AAGAAGAAGAAA Started job on | Feb 11 07:09:36 Started mapping on | Feb 11 07:09:54 Finished on | Feb 11 07:33:15 Mapping speed, Million of reads per hour | 87.85 Number of input reads | 34189572 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 32232953 Uniquely mapped reads % | 94.28% Average mapped length | 98.53 Number of splices: Total | 9006164 Number of splices: Annotated (sjdb) | 8831306 Number of splices: GT/AG | 8866297 Number of splices: GC/AG | 113307 Number of splices: AT/AC | 9212 Number of splices: Non-canonical | 17348 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 1.92 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 812820 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 463017 % of reads mapped to too many loci | 1.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1143799 1143799 1143799 N_multimapping 812820 812820 812820 N_noFeature 1407408 16718586 16674428 N_ambiguous 358618 55451 56312 UnstrandedReadsAssigned:30466927 PositiveStrandReadsAssigned:15458916 NegativeStrandReadsAssigned:15502213 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207836 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207836-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,189,572 reads, 31,671,733 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,256 rounds 52401 SRR3207836.ke.tsv 34699 SRR3207836.se.tsv 87100 total ==> SRR3207836.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1221 29.0706 Potri.005G024800.1.v4.1 1035 936 299 14.5952 Potri.004G059700.1.v4.1 961 862 30 1.59011 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 541.818 8.70436 Potri.016G087400.1.v4.1 270 171 1181.49 315.681 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 112 3.05686 Potri.012G127500.1.v4.1 977 878 4912 255.61 ==> SRR3207836.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3583 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 654 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 45 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207836 completed mapping pipeline successfully