Starting /dee2/code/volunteer_pipeline.sh SRR3207837 current disk space = 3054959288320 free memory = 1470741788 SRR3207837 SRAfilesize e119a28556902d8be8f93fc190d0290f SRR3207837.sra SRR3207837.sra file validated SRR3207837 is single end SRR3207837 is conventional basespace SRR3207837 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207837_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01225 34.0 33.0 34.0 31.0 34.0 2 33.30075 34.0 34.0 34.0 31.0 34.0 3 33.47725 34.0 34.0 34.0 31.0 34.0 4 36.721 37.0 37.0 37.0 35.0 37.0 5 36.691 37.0 37.0 37.0 35.0 37.0 6 36.67775 37.0 37.0 37.0 35.0 37.0 7 36.6535 37.0 37.0 37.0 35.0 37.0 8 36.59175 37.0 37.0 37.0 35.0 37.0 9 38.50625 39.0 39.0 39.0 37.0 39.0 10-11 38.594875 39.0 39.0 39.0 38.0 39.0 12-13 38.561 39.0 39.0 39.0 38.0 39.0 14-15 40.2435 41.0 40.0 41.0 39.0 41.0 16-17 40.251374999999996 41.0 40.0 41.0 39.0 41.0 18-19 40.254999999999995 41.0 40.0 41.0 39.0 41.0 20-21 40.255875 41.0 40.0 41.0 39.0 41.0 22-23 40.196749999999994 41.0 40.0 41.0 39.0 41.0 24-25 40.0895 41.0 40.0 41.0 38.0 41.0 26-27 39.984624999999994 41.0 40.0 41.0 38.0 41.0 28-29 39.922625 41.0 40.0 41.0 38.0 41.0 30-31 39.917 41.0 40.0 41.0 38.0 41.0 32-33 39.8945 41.0 40.0 41.0 38.0 41.0 34-35 39.876374999999996 41.0 40.0 41.0 38.0 41.0 36-37 39.760875 41.0 40.0 41.0 38.0 41.0 38-39 39.6455 41.0 40.0 41.0 38.0 41.0 40-41 39.63675 41.0 40.0 41.0 38.0 41.0 42-43 39.525999999999996 41.0 40.0 41.0 37.0 41.0 44-45 39.510625 41.0 40.0 41.0 37.0 41.0 46-47 39.494375 41.0 40.0 41.0 37.0 41.0 48-49 39.422875 41.0 40.0 41.0 37.0 41.0 50-51 39.301500000000004 41.0 39.5 41.0 36.5 41.0 52-53 39.161249999999995 41.0 39.0 41.0 36.0 41.0 54-55 39.023624999999996 41.0 39.0 41.0 36.0 41.0 56-57 39.045375 41.0 39.0 41.0 35.0 41.0 58-59 39.028625000000005 41.0 39.0 41.0 35.0 41.0 60-61 38.762125 40.5 38.0 41.0 35.0 41.0 62-63 38.636375 40.0 37.5 41.0 35.0 41.0 64-65 38.272125 39.5 37.0 41.0 35.0 41.0 66-67 37.969125000000005 39.0 36.5 41.0 35.0 41.0 68-69 37.556875 39.0 36.0 41.0 35.0 41.0 70-71 37.116375 37.5 35.5 40.0 34.0 41.0 72-73 36.7395 37.0 35.0 39.0 34.0 41.0 74-75 36.31825 37.0 35.0 39.0 34.0 40.5 76-77 34.54975 35.0 33.5 36.5 31.0 39.0 78-79 35.319374999999994 36.0 35.0 37.0 33.0 39.0 80-81 35.07775 35.0 35.0 37.0 33.0 39.0 82-83 34.841125 35.0 35.0 36.5 33.0 37.0 84-85 34.5685 35.0 35.0 36.0 33.0 37.0 86-87 34.234875 35.0 35.0 36.0 33.0 37.0 88-89 34.1995 35.0 35.0 35.0 33.0 36.0 90-91 34.014375 35.0 35.0 35.0 33.0 36.0 92-93 33.855625 35.0 35.0 35.0 32.5 36.0 94-95 33.825 35.0 35.0 35.0 32.5 36.0 96-97 33.779624999999996 35.0 35.0 35.0 33.0 36.0 98-99 33.641375 35.0 35.0 35.0 33.0 35.0 100 33.6035 35.0 35.0 35.0 33.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 3.0 12 2.0 13 2.0 14 5.0 15 2.0 16 1.0 17 2.0 18 4.0 19 2.0 20 3.0 21 1.0 22 5.0 23 4.0 24 3.0 25 6.0 26 9.0 27 10.0 28 8.0 29 20.0 30 26.0 31 36.0 32 30.0 33 39.0 34 64.0 35 103.0 36 228.0 37 814.0 38 1938.0 39 628.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.621997471554995 13.299620733249052 14.437420986093553 43.6409608091024 2 19.725 22.55 36.35 21.375 3 23.125 25.874999999999996 26.174999999999997 24.825 4 26.1 31.2 19.775000000000002 22.925 5 24.55 35.5 21.85 18.099999999999998 6 19.400000000000002 37.5 23.125 19.975 7 16.925 21.0 41.725 20.349999999999998 8 19.75 24.25 30.875000000000004 25.124999999999996 9 21.05 23.05 32.324999999999996 23.575 10-11 23.275000000000002 33.074999999999996 23.3125 20.3375 12-13 20.8 27.5125 29.037499999999998 22.650000000000002 14-15 20.325 28.1875 28.625 22.8625 16-17 21.75 27.900000000000002 27.950000000000003 22.400000000000002 18-19 21.9 27.825 27.987499999999997 22.287499999999998 20-21 22.287499999999998 27.800000000000004 27.712500000000002 22.2 22-23 21.6 28.5625 27.762500000000003 22.075 24-25 21.95 27.875 27.200000000000003 22.975 26-27 21.275 27.950000000000003 28.15 22.625 28-29 21.337500000000002 28.575 28.375 21.712500000000002 30-31 21.6 28.487499999999997 28.025 21.8875 32-33 22.5625 27.6875 28.1625 21.587500000000002 34-35 21.6125 28.6875 28.1 21.6 36-37 21.3875 28.037499999999998 27.437499999999996 23.1375 38-39 21.2375 28.999999999999996 27.650000000000002 22.112499999999997 40-41 21.6625 29.275000000000002 26.7625 22.3 42-43 21.4375 28.237499999999997 27.400000000000002 22.925 44-45 21.912499999999998 27.962500000000002 28.537499999999998 21.587500000000002 46-47 21.462500000000002 28.4125 27.474999999999998 22.650000000000002 48-49 22.1375 27.9375 28.0625 21.8625 50-51 22.7125 27.55 27.787499999999998 21.95 52-53 21.85 28.762500000000003 27.5125 21.875 54-55 22.375 27.737499999999997 28.125 21.762500000000003 56-57 21.087500000000002 27.35 28.6125 22.95 58-59 22.4625 27.200000000000003 28.1375 22.2 60-61 21.712500000000002 28.199999999999996 27.85 22.237499999999997 62-63 22.0 28.1 28.125 21.775 64-65 22.675 29.325000000000003 26.4125 21.587500000000002 66-67 21.2875 28.825 28.025 21.8625 68-69 22.037499999999998 28.1875 27.8625 21.912499999999998 70-71 22.018004501125283 28.032008002000502 27.84446111527882 22.1055263815954 72-73 21.7875 27.85 29.325000000000003 21.0375 74-75 21.875 26.9125 28.775000000000002 22.4375 76-77 22.030507626906726 27.46936734183546 27.33183295823956 23.168292073018254 78-79 22.2625 28.000000000000004 28.1625 21.575 80-81 21.4125 28.4125 28.1625 22.0125 82-83 21.837500000000002 28.4375 27.6125 22.112499999999997 84-85 22.0875 27.450000000000003 27.962500000000002 22.5 86-87 22.655663915978995 28.49462365591398 28.019504876219052 20.830207551887973 88-89 22.118029507376843 27.781945486371594 27.431857964491122 22.66816704176044 90-91 22.5 27.825 28.037499999999998 21.637500000000003 92-93 22.037499999999998 27.6875 28.425 21.85 94-95 22.35 28.249999999999996 27.712500000000002 21.6875 96-97 22.1 27.675 27.237499999999997 22.9875 98-99 21.9375 28.249999999999996 27.925 21.8875 100 21.349999999999998 29.049999999999997 28.499999999999996 21.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 3.0 26 4.0 27 4.0 28 4.0 29 7.0 30 14.0 31 19.5 32 29.5 33 40.0 34 48.5 35 67.5 36 92.0 37 113.0 38 132.5 39 174.0 40 211.0 41 236.0 42 250.5 43 255.5 44 262.0 45 273.5 46 266.0 47 241.5 48 237.0 49 209.5 50 170.5 51 140.5 52 105.0 53 82.5 54 80.5 55 60.0 56 37.5 57 31.0 58 20.0 59 15.5 60 13.5 61 9.0 62 7.5 63 8.0 64 6.5 65 3.5 66 2.5 67 3.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.025 72-73 0.0 74-75 0.0 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.025 88-89 0.025 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177545 spots for SRR3207837.sra Written 1177545 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra Read 1177536 spots for SRR3207837.sra Written 1177536 spots for SRR3207837.sra SRR ids: ['SRR3207837.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_junj_lnh SRR3207837.sra spots: 23550729 blocks: [[1, 1177536], [1177537, 2355072], [2355073, 3532608], [3532609, 4710144], [4710145, 5887680], [5887681, 7065216], [7065217, 8242752], [8242753, 9420288], [9420289, 10597824], [10597825, 11775360], [11775361, 12952896], [12952897, 14130432], [14130433, 15307968], [15307969, 16485504], [16485505, 17663040], [17663041, 18840576], [18840577, 20018112], [20018113, 21195648], [21195649, 22373184], [22373185, 23550729]] SRR3207837 file size 6130735 SRR3207837 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207837 SRR3207837_1.fastq Input file: SRR3207837_1.fastq trimmed: SRR3207837-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 06:37:40 2025 >> started Tue Feb 11 06:49:54 2025 >> done (733.973s) 23550729 reads processed; of these: 4924 ( 0.02%) short reads filtered out after trimming by size control 19928 ( 0.08%) empty reads filtered out after trimming by size control 23525877 (99.89%) reads available; of these: 1056386 ( 4.49%) trimmed reads available after processing 22469491 (95.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 543 0.00% 19 649 0.00% 20 841 0.00% 21 946 0.00% 22 1208 0.01% 23 1595 0.01% 24 2142 0.01% 25 2738 0.01% 26 2877 0.01% 27 2951 0.01% 28 3031 0.01% 29 3271 0.01% 30 3340 0.01% 31 3548 0.02% 32 3763 0.02% 33 3852 0.02% 34 4188 0.02% 35 4277 0.02% 36 4520 0.02% 37 4623 0.02% 38 5012 0.02% 39 5165 0.02% 40 5480 0.02% 41 5625 0.02% 42 5986 0.03% 43 6525 0.03% 44 6801 0.03% 45 7123 0.03% 46 7164 0.03% 47 7491 0.03% 48 7831 0.03% 49 7701 0.03% 50 7898 0.03% 51 8048 0.03% 52 8264 0.04% 53 8314 0.04% 54 8669 0.04% 55 8572 0.04% 56 8583 0.04% 57 8610 0.04% 58 9066 0.04% 59 9066 0.04% 60 9392 0.04% 61 9738 0.04% 62 9734 0.04% 63 10177 0.04% 64 10366 0.04% 65 10472 0.04% 66 10495 0.04% 67 11063 0.05% 68 11432 0.05% 69 11467 0.05% 70 12443 0.05% 71 12486 0.05% 72 13312 0.06% 73 13831 0.06% 74 14522 0.06% 75 15370 0.07% 76 7716 0.03% 77 8930 0.04% 78 10520 0.04% 79 11791 0.05% 80 12999 0.06% 81 13427 0.06% 82 14466 0.06% 83 16003 0.07% 84 16332 0.07% 85 17239 0.07% 86 18212 0.08% 87 20430 0.09% 88 21720 0.09% 89 23729 0.10% 90 25519 0.11% 91 27610 0.12% 92 30411 0.13% 93 33570 0.14% 94 38280 0.16% 95 43499 0.18% 96 49844 0.21% 97 57125 0.24% 98 63537 0.27% 99 69280 0.29% 100 22469491 95.51% 23525877 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=14.38 fanout-score-rank=8 prefix-density=0.10 prefix-fanout=14.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=10 fanout-score=187.81 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=25.8 sequence=AAGAAGAAGAAA Started job on | Feb 11 06:56:58 Started mapping on | Feb 11 06:57:16 Finished on | Feb 11 07:33:14 Mapping speed, Million of reads per hour | 39.25 Number of input reads | 23525877 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 22456894 Uniquely mapped reads % | 95.46% Average mapped length | 98.61 Number of splices: Total | 6301677 Number of splices: Annotated (sjdb) | 6179549 Number of splices: GT/AG | 6204646 Number of splices: GC/AG | 78980 Number of splices: AT/AC | 6696 Number of splices: Non-canonical | 11355 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 543761 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 165704 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 525222 525222 525222 N_multimapping 543761 543761 543761 N_noFeature 946360 11607341 11625072 N_ambiguous 246261 37692 38027 UnstrandedReadsAssigned:21264273 PositiveStrandReadsAssigned:10811861 NegativeStrandReadsAssigned:10793795 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207837 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207837-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,525,877 reads, 21,926,757 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,219 rounds 52401 SRR3207837.ke.tsv 34699 SRR3207837.se.tsv 87100 total ==> SRR3207837.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 812.459 27.8745 Potri.005G024800.1.v4.1 1035 936 193 13.5757 Potri.004G059700.1.v4.1 961 862 21 1.60396 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 381.184 8.8244 Potri.016G087400.1.v4.1 270 171 939 361.535 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 89 3.50038 Potri.012G127500.1.v4.1 977 878 3216 241.158 ==> SRR3207837.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2822 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 419 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207837 completed mapping pipeline successfully