Starting /dee2/code/volunteer_pipeline.sh SRR3207838 current disk space = 3055122882560 free memory = 1563812232 SRR3207838 SRAfilesize cffd6909ef5254662346d510215982c9 SRR3207838.sra SRR3207838.sra file validated SRR3207838 is single end SRR3207838 is conventional basespace SRR3207838 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207838_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90475 34.0 33.0 34.0 31.0 34.0 2 33.245 34.0 34.0 34.0 31.0 34.0 3 33.4455 34.0 34.0 34.0 31.0 34.0 4 36.697 37.0 37.0 37.0 35.0 37.0 5 36.6805 37.0 37.0 37.0 35.0 37.0 6 36.69225 37.0 37.0 37.0 35.0 37.0 7 36.66275 37.0 37.0 37.0 35.0 37.0 8 36.66125 37.0 37.0 37.0 35.0 37.0 9 38.5595 39.0 39.0 39.0 38.0 39.0 10-11 38.61687499999999 39.0 39.0 39.0 38.0 39.0 12-13 38.608125 39.0 39.0 39.0 38.0 39.0 14-15 40.288375 41.0 40.5 41.0 39.0 41.0 16-17 40.266625 41.0 40.0 41.0 39.0 41.0 18-19 40.2775 41.0 40.0 41.0 39.0 41.0 20-21 40.256625 41.0 40.0 41.0 39.0 41.0 22-23 40.227625 41.0 40.0 41.0 39.0 41.0 24-25 40.085499999999996 41.0 40.0 41.0 38.0 41.0 26-27 40.04575 41.0 40.0 41.0 38.0 41.0 28-29 39.937125 41.0 40.0 41.0 38.0 41.0 30-31 39.995374999999996 41.0 40.0 41.0 38.0 41.0 32-33 39.884625 41.0 40.0 41.0 38.0 41.0 34-35 39.86175 41.0 40.0 41.0 38.0 41.0 36-37 39.764250000000004 41.0 40.0 41.0 38.0 41.0 38-39 39.682249999999996 41.0 40.0 41.0 37.5 41.0 40-41 39.696375 41.0 40.0 41.0 38.0 41.0 42-43 39.547 41.0 40.0 41.0 37.5 41.0 44-45 39.498625000000004 41.0 40.0 41.0 37.0 41.0 46-47 39.490750000000006 41.0 40.0 41.0 37.0 41.0 48-49 39.443749999999994 41.0 40.0 41.0 37.0 41.0 50-51 39.297375 41.0 39.0 41.0 36.5 41.0 52-53 39.164875 41.0 39.0 41.0 36.0 41.0 54-55 39.00925 41.0 39.0 41.0 36.0 41.0 56-57 39.066 41.0 39.0 41.0 35.5 41.0 58-59 39.054625 41.0 39.0 41.0 35.0 41.0 60-61 38.821749999999994 41.0 39.0 41.0 35.0 41.0 62-63 38.642875000000004 40.0 37.5 41.0 35.0 41.0 64-65 38.266000000000005 39.5 37.0 41.0 35.0 41.0 66-67 38.013000000000005 39.0 36.5 41.0 35.0 41.0 68-69 37.6275 39.0 36.0 41.0 35.0 41.0 70-71 37.208875 38.0 35.5 40.0 34.5 41.0 72-73 36.739875 37.0 35.0 39.0 34.0 41.0 74-75 36.33 37.0 35.0 39.0 34.0 41.0 76-77 34.677625000000006 35.0 33.5 37.0 31.0 39.0 78-79 35.38312500000001 36.0 35.0 37.0 33.5 39.0 80-81 35.164874999999995 35.0 35.0 37.0 34.0 39.0 82-83 34.913375 35.0 35.0 36.0 33.5 37.0 84-85 34.64149999999999 35.0 35.0 36.0 33.5 37.0 86-87 34.329875 35.0 35.0 36.0 33.0 36.5 88-89 34.219125 35.0 35.0 35.0 33.0 36.0 90-91 34.050375 35.0 35.0 35.0 33.0 36.0 92-93 33.9775 35.0 35.0 35.0 33.0 36.0 94-95 33.91 35.0 35.0 35.0 33.0 36.0 96-97 33.8485 35.0 35.0 35.0 33.0 36.0 98-99 33.7355 35.0 35.0 35.0 33.0 35.0 100 33.69475 35.0 35.0 35.0 33.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 3.0 12 2.0 13 0.0 14 3.0 15 2.0 16 3.0 17 7.0 18 2.0 19 3.0 20 4.0 21 3.0 22 5.0 23 3.0 24 3.0 25 7.0 26 10.0 27 6.0 28 9.0 29 6.0 30 21.0 31 28.0 32 38.0 33 41.0 34 52.0 35 115.0 36 255.0 37 761.0 38 2012.0 39 594.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.248730964467008 15.17766497461929 13.730964467005077 42.84263959390863 2 19.225 23.325000000000003 35.375 22.075 3 21.5 26.75 26.6 25.15 4 24.9 32.25 20.575 22.275 5 24.456114028507127 34.48362090522631 22.030507626906726 19.02975743935984 6 18.875 37.225 24.099999999999998 19.8 7 17.0 20.200000000000003 42.3 20.5 8 19.375 22.425 31.05 27.150000000000002 9 20.724999999999998 24.175 30.95 24.15 10-11 22.55 33.85 22.237499999999997 21.3625 12-13 20.2375 26.775 30.012499999999996 22.975 14-15 20.3875 27.3125 29.3875 22.912499999999998 16-17 22.175 27.150000000000002 27.8125 22.8625 18-19 21.337500000000002 28.9125 27.5625 22.1875 20-21 21.762500000000003 27.500000000000004 27.437499999999996 23.3 22-23 21.3125 28.4375 27.450000000000003 22.8 24-25 21.337500000000002 28.325 28.050000000000004 22.287499999999998 26-27 21.475 29.099999999999998 27.750000000000004 21.675 28-29 21.212500000000002 27.8375 27.975 22.975 30-31 22.037499999999998 28.8375 26.937499999999996 22.1875 32-33 21.4125 29.099999999999998 27.0125 22.475 34-35 22.175 28.65 27.025 22.15 36-37 21.125 28.3375 28.0625 22.475 38-39 22.025 28.3625 27.525 22.0875 40-41 21.1625 28.675 27.625 22.537499999999998 42-43 22.237499999999997 29.25 27.250000000000004 21.2625 44-45 20.962500000000002 28.462500000000002 28.175 22.400000000000002 46-47 22.912499999999998 27.925 27.275 21.8875 48-49 22.25 27.5625 27.8625 22.325 50-51 21.4 28.625 27.474999999999998 22.5 52-53 21.5625 29.012500000000003 27.737499999999997 21.6875 54-55 22.2625 27.712500000000002 28.8375 21.1875 56-57 21.1625 28.575 28.299999999999997 21.9625 58-59 22.375 28.375 27.275 21.975 60-61 21.1875 27.450000000000003 29.325000000000003 22.037499999999998 62-63 21.475 27.275 27.900000000000002 23.35 64-65 22.412499999999998 28.1375 27.0875 22.3625 66-67 21.7375 28.3375 28.325 21.6 68-69 22.400000000000002 27.775 28.512500000000003 21.3125 70-71 21.49018627328416 28.42855356919615 27.790973871733964 22.290286285785722 72-73 21.95 27.462500000000002 27.725 22.8625 74-75 22.275 27.712500000000002 28.0875 21.925 76-77 21.09013626703338 28.82860357544693 27.803475434429302 22.277784723090384 78-79 21.6625 28.212500000000002 27.9125 22.2125 80-81 22.4375 28.050000000000004 27.750000000000004 21.762500000000003 82-83 21.875 28.7 27.9125 21.512500000000003 84-85 22.5125 27.487499999999997 27.9375 22.0625 86-87 21.927740967620952 27.853481685210653 28.028503562945367 22.190273784223027 88-89 20.840105013126642 28.316039504938118 28.291036379547442 22.552819102387797 90-91 21.825 27.8375 28.212500000000002 22.125 92-93 22.287499999999998 27.075 28.487499999999997 22.15 94-95 21.4375 29.175 27.450000000000003 21.9375 96-97 21.9625 28.225 27.537499999999998 22.275 98-99 22.1375 27.500000000000004 28.4375 21.925 100 22.25 27.85 28.65 21.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 3.0 26 4.0 27 5.0 28 7.5 29 10.5 30 20.0 31 26.5 32 28.5 33 35.5 34 48.0 35 71.0 36 92.5 37 109.0 38 134.0 39 171.0 40 189.5 41 204.5 42 243.5 43 277.0 44 283.0 45 290.5 46 296.0 47 267.0 48 224.0 49 183.5 50 155.5 51 136.0 52 117.5 53 92.0 54 68.5 55 47.0 56 33.0 57 27.0 58 16.0 59 12.0 60 12.5 61 12.0 62 11.5 63 9.0 64 4.5 65 3.5 66 2.5 67 2.5 68 2.5 69 1.0 70 1.0 71 0.0 72 0.5 73 1.5 74 1.0 75 0.5 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0125 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326366 spots for SRR3207838.sra Written 1326366 spots for SRR3207838.sra Read 1326382 spots for SRR3207838.sra Written 1326382 spots for SRR3207838.sra SRR ids: ['SRR3207838.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q_ez4i1y SRR3207838.sra spots: 26527336 blocks: [[1, 1326366], [1326367, 2652732], [2652733, 3979098], [3979099, 5305464], [5305465, 6631830], [6631831, 7958196], [7958197, 9284562], [9284563, 10610928], [10610929, 11937294], [11937295, 13263660], [13263661, 14590026], [14590027, 15916392], [15916393, 17242758], [17242759, 18569124], [18569125, 19895490], [19895491, 21221856], [21221857, 22548222], [22548223, 23874588], [23874589, 25200954], [25200955, 26527336]] SRR3207838 file size 6906961 SRR3207838 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207838 SRR3207838_1.fastq Input file: SRR3207838_1.fastq trimmed: SRR3207838-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 07:33:31 2025 >> started Tue Feb 11 07:33:45 2025 >> done (13.906s) 26527336 reads processed; of these: 5537 ( 0.02%) short reads filtered out after trimming by size control 12131 ( 0.05%) empty reads filtered out after trimming by size control 26509668 (99.93%) reads available; of these: 1189170 ( 4.49%) trimmed reads available after processing 25320498 (95.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 583 0.00% 19 699 0.00% 20 862 0.00% 21 1039 0.00% 22 1331 0.01% 23 1955 0.01% 24 2458 0.01% 25 3155 0.01% 26 3197 0.01% 27 3276 0.01% 28 3572 0.01% 29 3803 0.01% 30 4000 0.02% 31 4162 0.02% 32 4355 0.02% 33 4488 0.02% 34 4969 0.02% 35 5189 0.02% 36 5260 0.02% 37 5571 0.02% 38 5514 0.02% 39 6112 0.02% 40 6230 0.02% 41 6739 0.03% 42 6858 0.03% 43 7457 0.03% 44 8026 0.03% 45 7859 0.03% 46 8278 0.03% 47 8572 0.03% 48 9000 0.03% 49 9063 0.03% 50 9283 0.04% 51 9514 0.04% 52 9642 0.04% 53 9764 0.04% 54 9739 0.04% 55 9813 0.04% 56 10018 0.04% 57 10169 0.04% 58 10403 0.04% 59 10376 0.04% 60 10561 0.04% 61 11136 0.04% 62 11017 0.04% 63 11328 0.04% 64 12072 0.05% 65 11884 0.04% 66 12181 0.05% 67 12747 0.05% 68 13121 0.05% 69 12960 0.05% 70 14007 0.05% 71 14074 0.05% 72 14855 0.06% 73 15270 0.06% 74 16385 0.06% 75 17210 0.06% 76 8683 0.03% 77 10035 0.04% 78 11913 0.04% 79 13418 0.05% 80 14351 0.05% 81 14942 0.06% 82 15971 0.06% 83 17695 0.07% 84 18369 0.07% 85 19431 0.07% 86 20556 0.08% 87 22739 0.09% 88 24293 0.09% 89 26117 0.10% 90 28062 0.11% 91 30936 0.12% 92 33914 0.13% 93 37276 0.14% 94 42577 0.16% 95 47923 0.18% 96 55180 0.21% 97 63184 0.24% 98 70802 0.27% 99 77642 0.29% 100 25320498 95.51% 26509668 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=13.30 fanout-score-rank=13 prefix-density=0.08 prefix-fanout=13.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=306.20 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=28.4 sequence=TTCTTCTTCTTT Started job on | Feb 11 07:34:00 Started mapping on | Feb 11 07:34:01 Finished on | Feb 11 07:34:27 Mapping speed, Million of reads per hour | 3670.57 Number of input reads | 26509668 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 25135217 Uniquely mapped reads % | 94.82% Average mapped length | 98.60 Number of splices: Total | 7243485 Number of splices: Annotated (sjdb) | 7099894 Number of splices: GT/AG | 7130796 Number of splices: GC/AG | 92096 Number of splices: AT/AC | 7424 Number of splices: Non-canonical | 13169 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 1.96 Insertion rate per base | 0.01% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 607934 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 274463 % of reads mapped to too many loci | 1.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.85% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 766517 766517 766517 N_multimapping 607934 607934 607934 N_noFeature 1125367 13043881 13039397 N_ambiguous 265659 44082 44655 UnstrandedReadsAssigned:23744191 PositiveStrandReadsAssigned:12047254 NegativeStrandReadsAssigned:12051165 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207838 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207838-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,509,668 reads, 24,554,504 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,288 rounds 52401 SRR3207838.ke.tsv 34699 SRR3207838.se.tsv 87100 total ==> SRR3207838.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1020 31.8396 Potri.005G024800.1.v4.1 1035 936 190 12.1596 Potri.004G059700.1.v4.1 961 862 18 1.25086 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 405.499 8.54088 Potri.016G087400.1.v4.1 270 171 918 321.58 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 121 4.32985 Potri.012G127500.1.v4.1 977 878 4787 326.597 ==> SRR3207838.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3429 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 473 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR3207838 completed mapping pipeline successfully