Starting /dee2/code/volunteer_pipeline.sh SRR3207839 current disk space = 3055095218176 free memory = 1472383176 SRR3207839 SRAfilesize c6309041bb0c6fc9ad2ea81bd977ce33 SRR3207839.sra SRR3207839.sra file validated SRR3207839 is single end SRR3207839 is conventional basespace SRR3207839 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207839_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94775 34.0 33.0 34.0 31.0 34.0 2 33.28925 34.0 34.0 34.0 31.0 34.0 3 33.49725 34.0 34.0 34.0 31.0 34.0 4 36.72275 37.0 37.0 37.0 37.0 37.0 5 36.6835 37.0 37.0 37.0 35.0 37.0 6 36.68975 37.0 37.0 37.0 37.0 37.0 7 36.698 37.0 37.0 37.0 36.0 37.0 8 36.6455 37.0 37.0 37.0 35.0 37.0 9 38.5275 39.0 39.0 39.0 38.0 39.0 10-11 38.6155 39.0 39.0 39.0 38.0 39.0 12-13 38.574250000000006 39.0 39.0 39.0 38.0 39.0 14-15 40.242 41.0 40.5 41.0 39.0 41.0 16-17 40.248875 41.0 40.0 41.0 39.0 41.0 18-19 40.31225 41.0 40.0 41.0 39.0 41.0 20-21 40.3 41.0 40.0 41.0 39.0 41.0 22-23 40.19725 41.0 40.0 41.0 39.0 41.0 24-25 40.07575 41.0 40.0 41.0 38.0 41.0 26-27 39.991875 41.0 40.0 41.0 38.0 41.0 28-29 39.9285 41.0 40.0 41.0 38.0 41.0 30-31 39.942750000000004 41.0 40.0 41.0 38.0 41.0 32-33 39.911375 41.0 40.0 41.0 38.0 41.0 34-35 39.876875 41.0 40.0 41.0 38.0 41.0 36-37 39.7785 41.0 40.0 41.0 38.0 41.0 38-39 39.6345 41.0 40.0 41.0 38.0 41.0 40-41 39.58025 41.0 40.0 41.0 37.5 41.0 42-43 39.509875 41.0 40.0 41.0 37.0 41.0 44-45 39.516125 41.0 40.0 41.0 37.0 41.0 46-47 39.543625 41.0 40.0 41.0 37.0 41.0 48-49 39.475375 41.0 40.0 41.0 37.0 41.0 50-51 39.3065 41.0 39.5 41.0 36.5 41.0 52-53 39.221125 41.0 39.0 41.0 36.0 41.0 54-55 39.085750000000004 41.0 39.0 41.0 35.5 41.0 56-57 39.126374999999996 41.0 39.0 41.0 36.0 41.0 58-59 39.07825 41.0 39.0 41.0 35.0 41.0 60-61 38.83725 40.5 39.0 41.0 35.0 41.0 62-63 38.660624999999996 40.0 38.0 41.0 35.0 41.0 64-65 38.299625 40.0 37.0 41.0 35.0 41.0 66-67 38.06375 39.0 37.0 41.0 35.0 41.0 68-69 37.693875 39.0 36.0 41.0 35.0 41.0 70-71 37.267250000000004 38.5 35.5 40.0 34.5 41.0 72-73 36.8425 37.0 35.0 39.0 34.0 41.0 74-75 36.379 37.0 35.0 39.0 34.0 41.0 76-77 34.65325 35.5 33.5 37.0 31.0 39.0 78-79 35.436375 36.0 35.0 37.0 33.5 39.0 80-81 35.1275 35.0 35.0 37.0 34.0 39.0 82-83 34.85175 35.0 35.0 36.5 34.0 37.0 84-85 34.563125 35.0 35.0 36.0 33.0 37.0 86-87 34.257875 35.0 35.0 36.0 33.0 37.0 88-89 34.162875 35.0 35.0 35.5 33.0 36.0 90-91 33.960499999999996 35.0 35.0 35.0 33.0 36.0 92-93 33.887375 35.0 35.0 35.0 33.0 36.0 94-95 33.817875 35.0 35.0 35.0 33.0 36.0 96-97 33.746375 35.0 35.0 35.0 33.0 36.0 98-99 33.650999999999996 35.0 35.0 35.0 33.0 35.5 100 33.56025 35.0 35.0 35.0 33.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 0.0 13 0.0 14 4.0 15 4.0 16 1.0 17 1.0 18 0.0 19 6.0 20 7.0 21 2.0 22 4.0 23 4.0 24 6.0 25 10.0 26 7.0 27 11.0 28 9.0 29 10.0 30 23.0 31 34.0 32 40.0 33 41.0 34 55.0 35 93.0 36 227.0 37 738.0 38 2039.0 39 618.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.82145574435709 14.65888917068222 15.77479076845042 41.744864316510274 2 20.424999999999997 22.95 35.625 21.0 3 22.0 26.0 25.900000000000002 26.1 4 24.525 31.2 19.775000000000002 24.5 5 24.825 34.475 22.2 18.5 6 19.525000000000002 36.975 23.974999999999998 19.525000000000002 7 17.599999999999998 18.875 42.625 20.9 8 20.075000000000003 23.875 29.875 26.174999999999997 9 20.375 24.224999999999998 31.1 24.3 10-11 22.925 33.1625 23.8125 20.1 12-13 21.375 25.974999999999998 30.175 22.475 14-15 21.4375 28.4 28.462500000000002 21.7 16-17 21.712500000000002 28.5875 26.7625 22.9375 18-19 21.212500000000002 29.275000000000002 27.474999999999998 22.037499999999998 20-21 22.9875 27.925 27.35 21.7375 22-23 21.3125 28.749999999999996 27.962500000000002 21.975 24-25 21.075 28.15 27.4125 23.3625 26-27 21.4 28.925 27.987499999999997 21.6875 28-29 21.099999999999998 28.6125 27.3375 22.95 30-31 21.2875 28.775000000000002 28.15 21.7875 32-33 21.9375 29.062500000000004 26.8625 22.1375 34-35 22.525000000000002 29.175 27.287499999999998 21.0125 36-37 21.2 28.749999999999996 27.737499999999997 22.3125 38-39 22.3875 28.962500000000002 27.4125 21.2375 40-41 22.35 28.7375 27.875 21.0375 42-43 21.4375 28.375 28.3375 21.85 44-45 21.875 28.487499999999997 28.3125 21.325 46-47 22.45 28.487499999999997 27.8125 21.25 48-49 21.837500000000002 28.462500000000002 28.15 21.55 50-51 21.1375 28.512500000000003 28.1875 22.162499999999998 52-53 22.25 27.825 28.1 21.825 54-55 22.35 27.5125 27.85 22.287499999999998 56-57 22.575 27.975 27.725 21.725 58-59 22.7125 27.875 28.212500000000002 21.2 60-61 21.4875 28.175 28.487499999999997 21.85 62-63 22.9375 27.787499999999998 28.15 21.125 64-65 21.875 28.000000000000004 27.537499999999998 22.5875 66-67 21.4125 28.15 28.5625 21.875 68-69 22.35 27.450000000000003 28.15 22.05 70-71 21.115139392424055 28.091011376422053 28.716089511188898 22.077759719964995 72-73 21.9625 28.812500000000004 28.025 21.2 74-75 21.2875 27.762500000000003 28.65 22.3 76-77 21.1375 28.8875 27.400000000000002 22.575 78-79 22.425 28.037499999999998 27.8625 21.675 80-81 21.2 28.512500000000003 28.0875 22.2 82-83 21.8125 27.6125 28.525 22.05 84-85 21.337500000000002 28.199999999999996 28.237499999999997 22.225 86-87 22.15 26.775 28.8375 22.237499999999997 88-89 22.3125 28.025 27.825 21.837500000000002 90-91 21.6 28.075 28.537499999999998 21.7875 92-93 21.8 28.0625 28.1625 21.975 94-95 21.775 28.4125 28.1375 21.675 96-97 21.3875 27.675 29.312500000000004 21.625 98-99 22.412499999999998 27.800000000000004 28.749999999999996 21.0375 100 22.225 27.525 27.950000000000003 22.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 1.0 25 1.0 26 2.5 27 2.5 28 4.5 29 10.0 30 13.0 31 21.5 32 33.5 33 46.0 34 59.5 35 82.0 36 116.0 37 136.5 38 153.0 39 169.5 40 190.0 41 231.5 42 258.0 43 249.5 44 248.5 45 265.0 46 272.0 47 243.0 48 209.5 49 188.5 50 161.5 51 129.5 52 109.0 53 98.0 54 68.5 55 50.5 56 42.0 57 29.5 58 22.0 59 15.5 60 12.5 61 9.5 62 8.5 63 8.0 64 5.5 65 3.5 66 1.5 67 3.0 68 3.0 69 0.5 70 2.0 71 2.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.2005515166708448 0.4 3 0.0 0.0 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.037500000000000006 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.0625 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.0875 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1375 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88 0.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365412 spots for SRR3207839.sra Written 1365412 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra Read 1365393 spots for SRR3207839.sra Written 1365393 spots for SRR3207839.sra SRR ids: ['SRR3207839.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ta7w792s SRR3207839.sra spots: 27307879 blocks: [[1, 1365393], [1365394, 2730786], [2730787, 4096179], [4096180, 5461572], [5461573, 6826965], [6826966, 8192358], [8192359, 9557751], [9557752, 10923144], [10923145, 12288537], [12288538, 13653930], [13653931, 15019323], [15019324, 16384716], [16384717, 17750109], [17750110, 19115502], [19115503, 20480895], [20480896, 21846288], [21846289, 23211681], [23211682, 24577074], [24577075, 25942467], [25942468, 27307879]] SRR3207839 file size 7110539 SRR3207839 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207839 SRR3207839_1.fastq Input file: SRR3207839_1.fastq trimmed: SRR3207839-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 07:33:45 2025 >> started Tue Feb 11 07:33:57 2025 >> done (11.935s) 27307879 reads processed; of these: 4888 ( 0.02%) short reads filtered out after trimming by size control 43035 ( 0.16%) empty reads filtered out after trimming by size control 27259956 (99.82%) reads available; of these: 1246072 ( 4.57%) trimmed reads available after processing 26013884 (95.43%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 542 0.00% 19 609 0.00% 20 816 0.00% 21 999 0.00% 22 1418 0.01% 23 1928 0.01% 24 2697 0.01% 25 3397 0.01% 26 3477 0.01% 27 3673 0.01% 28 3678 0.01% 29 3933 0.01% 30 4098 0.02% 31 4312 0.02% 32 4687 0.02% 33 4689 0.02% 34 5128 0.02% 35 5413 0.02% 36 5383 0.02% 37 5870 0.02% 38 6007 0.02% 39 6282 0.02% 40 6576 0.02% 41 6912 0.03% 42 7199 0.03% 43 7994 0.03% 44 8416 0.03% 45 8267 0.03% 46 8822 0.03% 47 8798 0.03% 48 9237 0.03% 49 9455 0.03% 50 9671 0.04% 51 9716 0.04% 52 9990 0.04% 53 10114 0.04% 54 10394 0.04% 55 10201 0.04% 56 10451 0.04% 57 10813 0.04% 58 10838 0.04% 59 10907 0.04% 60 11013 0.04% 61 11816 0.04% 62 11693 0.04% 63 12137 0.04% 64 12574 0.05% 65 12573 0.05% 66 12766 0.05% 67 13205 0.05% 68 13854 0.05% 69 13784 0.05% 70 14589 0.05% 71 14780 0.05% 72 15454 0.06% 73 16142 0.06% 74 17223 0.06% 75 18068 0.07% 76 9130 0.03% 77 10479 0.04% 78 12897 0.05% 79 14088 0.05% 80 15027 0.06% 81 15722 0.06% 82 16942 0.06% 83 18491 0.07% 84 19023 0.07% 85 20222 0.07% 86 21820 0.08% 87 23732 0.09% 88 25786 0.09% 89 27373 0.10% 90 29733 0.11% 91 32538 0.12% 92 35780 0.13% 93 39191 0.14% 94 44906 0.16% 95 50238 0.18% 96 57890 0.21% 97 66293 0.24% 98 73953 0.27% 99 79340 0.29% 100 26013884 95.43% 27259956 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=17.01 fanout-score-rank=21 prefix-density=0.12 prefix-fanout=17.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=13 fanout-score=299.26 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=28.2 sequence=TTCTTCTTCTTC Started job on | Feb 11 07:34:13 Started mapping on | Feb 11 07:34:13 Finished on | Feb 11 07:34:42 Mapping speed, Million of reads per hour | 3383.99 Number of input reads | 27259956 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 25888736 Uniquely mapped reads % | 94.97% Average mapped length | 98.62 Number of splices: Total | 6951700 Number of splices: Annotated (sjdb) | 6807347 Number of splices: GT/AG | 6840183 Number of splices: GC/AG | 90123 Number of splices: AT/AC | 7499 Number of splices: Non-canonical | 13895 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.02% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 650073 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 284899 % of reads mapped to too many loci | 1.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.59% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 721147 721147 721147 N_multimapping 650073 650073 650073 N_noFeature 1235528 13456550 13469759 N_ambiguous 294451 48449 48546 UnstrandedReadsAssigned:24358757 PositiveStrandReadsAssigned:12383737 NegativeStrandReadsAssigned:12370431 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207839 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207839-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,259,956 reads, 25,176,746 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,243 rounds 52401 SRR3207839.ke.tsv 34699 SRR3207839.se.tsv 87100 total ==> SRR3207839.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1289.54 37.5473 Potri.005G024800.1.v4.1 1035 936 961 57.3676 Potri.004G059700.1.v4.1 961 862 45 2.91692 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 442.311 8.68994 Potri.016G087400.1.v4.1 270 171 907 296.367 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 116.567 3.89081 Potri.012G127500.1.v4.1 977 878 6806 433.128 ==> SRR3207839.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3092 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 611 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR3207839 completed mapping pipeline successfully