Starting /dee2/code/volunteer_pipeline.sh SRR3207840 current disk space = 3055956262912 free memory = 1398921620 SRR3207840 SRAfilesize 3039ce0b107f80e8a795f9ac3bbef2d4 SRR3207840.sra SRR3207840.sra file validated SRR3207840 is single end SRR3207840 is conventional basespace SRR3207840 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207840_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.23 34.0 31.0 34.0 31.0 34.0 2 32.5555 34.0 31.0 34.0 31.0 34.0 3 31.46575 34.0 31.0 34.0 27.0 34.0 4 35.8655 37.0 35.0 37.0 33.0 37.0 5 36.00475 37.0 35.0 37.0 35.0 37.0 6 36.13275 37.0 36.0 37.0 35.0 37.0 7 36.16225 37.0 36.0 37.0 35.0 37.0 8 36.20375 37.0 37.0 37.0 35.0 37.0 9 37.948 39.0 38.0 39.0 35.0 39.0 10-11 37.9645 39.0 38.0 39.0 35.0 39.0 12-13 37.907 39.0 38.0 39.0 35.0 39.0 14-15 39.493875 41.0 39.0 41.0 36.0 41.0 16-17 39.452 41.0 39.0 41.0 36.5 41.0 18-19 39.393875 41.0 39.0 41.0 36.0 41.0 20-21 39.369125 41.0 39.0 41.0 36.0 41.0 22-23 39.236374999999995 41.0 39.0 41.0 36.0 41.0 24-25 39.22525 41.0 39.0 41.0 36.0 41.0 26-27 38.9855 40.0 38.5 41.0 35.5 41.0 28-29 39.02375000000001 40.0 39.0 41.0 36.0 41.0 30-31 38.905 40.0 38.5 41.0 35.0 41.0 32-33 38.709875 40.0 38.0 41.0 35.0 41.0 34-35 38.603125000000006 40.0 38.0 41.0 34.5 41.0 36-37 38.29475 40.0 38.0 41.0 34.0 41.0 38-39 38.360749999999996 40.0 38.0 41.0 34.0 41.0 40-41 38.327124999999995 40.0 38.0 41.0 34.0 41.0 42-43 38.292 40.0 38.0 41.0 34.0 41.0 44-45 38.27775 40.0 38.0 41.0 33.5 41.0 46-47 38.065625 40.0 38.0 41.0 33.0 41.0 48-49 37.78875 40.0 38.0 41.0 33.0 41.0 50-51 37.838750000000005 40.0 38.0 41.0 33.0 41.0 52-53 38.160375 40.0 38.0 41.0 33.5 41.0 54-55 38.181 40.0 38.0 41.0 33.5 41.0 56-57 38.024875 40.0 37.5 41.0 33.5 41.0 58-59 37.866625 40.0 37.0 41.0 33.0 41.0 60-61 37.644625000000005 40.0 37.0 41.0 33.0 41.0 62-63 37.263875 39.0 36.0 41.0 32.0 41.0 64-65 37.047 39.0 36.0 41.0 32.0 41.0 66-67 36.810500000000005 38.5 35.0 40.5 32.0 41.0 68-69 36.337 37.5 35.0 40.0 31.0 41.0 70-71 35.890625 37.0 35.0 39.5 31.0 41.0 72-73 35.334999999999994 36.5 35.0 39.0 30.5 41.0 74-75 34.837125 36.0 34.0 38.5 29.5 40.0 76-77 33.282 34.5 32.0 36.5 27.5 39.0 78-79 33.964625 35.0 34.0 37.0 29.5 39.0 80-81 33.83575 35.0 34.0 36.5 29.0 38.0 82-83 33.538 35.0 34.0 36.0 29.5 37.0 84-85 33.22675 35.0 34.0 36.0 29.0 37.0 86-87 32.989625000000004 35.0 34.0 35.0 29.0 36.5 88-89 32.8345 35.0 34.0 35.0 29.0 36.0 90-91 32.58425 35.0 33.5 35.0 29.0 36.0 92-93 32.335875 35.0 33.0 35.0 28.0 36.0 94-95 31.972875000000002 35.0 33.0 35.0 26.5 35.0 96-97 31.744 35.0 33.0 35.0 25.5 35.0 98-99 31.534125 35.0 33.0 35.0 25.5 35.0 100 31.4365 35.0 33.0 35.0 26.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 2.0 10 7.0 11 1.0 12 5.0 13 5.0 14 3.0 15 4.0 16 5.0 17 3.0 18 5.0 19 6.0 20 7.0 21 8.0 22 8.0 23 7.0 24 13.0 25 17.0 26 13.0 27 34.0 28 38.0 29 44.0 30 53.0 31 65.0 32 85.0 33 133.0 34 158.0 35 234.0 36 406.0 37 946.0 38 1389.0 39 293.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.83156297420334 14.390490642387455 15.30096105209914 41.47698533131007 2 21.099999999999998 23.35 34.725 20.825 3 22.311155577788895 26.513256628314156 26.013006503251624 25.162581290645324 4 25.074999999999996 32.800000000000004 20.175 21.95 5 24.15 34.8 22.575 18.475 6 18.875 38.1 25.05 17.974999999999998 7 17.025000000000002 20.3 40.949999999999996 21.725 8 19.75 24.175 29.925 26.150000000000002 9 20.525 23.875 31.7 23.9 10-11 23.3875 33.25 22.8 20.5625 12-13 20.925 27.175 28.537499999999998 23.3625 14-15 21.1875 28.237499999999997 28.95 21.625 16-17 20.9375 28.050000000000004 28.175 22.8375 18-19 21.712500000000002 28.1 27.187499999999996 23.0 20-21 21.275 27.6 28.775000000000002 22.35 22-23 22.1875 28.65 27.6625 21.5 24-25 21.4375 29.075 27.6625 21.825 26-27 22.325 29.4875 27.075 21.1125 28-29 22.3 28.6875 26.900000000000002 22.112499999999997 30-31 21.6625 27.712500000000002 28.5625 22.0625 32-33 21.95 28.025 27.212500000000002 22.8125 34-35 21.8875 28.3375 27.325 22.45 36-37 22.3875 28.449999999999996 27.1125 22.05 38-39 22.900000000000002 28.349999999999998 27.200000000000003 21.55 40-41 21.875 28.8625 26.687499999999996 22.575 42-43 21.337500000000002 29.15 27.2625 22.25 44-45 21.712500000000002 28.449999999999996 27.125 22.7125 46-47 21.970739027135174 28.848318119294735 27.897961735650867 21.28298111791922 48-49 21.927409261576972 27.83479349186483 28.46057571964956 21.777221526908637 50-51 21.42946551508324 28.02603579922393 27.975966954562526 22.568531731130303 52-53 22.238899312070043 27.34208880550344 28.242651657285805 22.176360225140712 54-55 22.175 27.750000000000004 28.425 21.65 56-57 21.65 28.599999999999998 27.250000000000004 22.5 58-59 22.0 28.1625 27.975 21.8625 60-61 22.675 28.0625 28.1625 21.099999999999998 62-63 22.275 28.075 28.1 21.55 64-65 21.8 28.8375 27.55 21.8125 66-67 23.05 27.775 27.800000000000004 21.375 68-69 22.3875 28.449999999999996 27.3625 21.8 70-71 21.912499999999998 28.525 27.800000000000004 21.762500000000003 72-73 22.825 27.712500000000002 27.3 22.162499999999998 74-75 21.075672295184493 28.392745465916196 28.355222013758596 22.176360225140712 76-77 22.36545682102628 26.382978723404253 28.52315394242804 22.728410513141426 78-79 21.305326331582897 28.982245561390346 27.719429857464366 21.99299824956239 80-81 22.287499999999998 27.762500000000003 28.1 21.85 82-83 22.775000000000002 27.3875 27.5875 22.25 84-85 21.65 28.1625 27.775 22.412499999999998 86-87 22.112499999999997 27.8375 28.537499999999998 21.512500000000003 88-89 22.537499999999998 27.6875 28.0875 21.6875 90-91 21.475 28.1 28.625 21.8 92-93 22.3 28.175 27.975 21.55 94-95 22.775000000000002 28.012500000000003 27.8875 21.325 96-97 22.225 28.050000000000004 28.1625 21.5625 98-99 22.304228171128347 28.3087315486615 27.495621716287218 21.891418563922944 100 21.630407601900476 28.457114278569644 26.9567391847962 22.95573893473368 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.5 25 2.0 26 3.0 27 4.5 28 7.5 29 10.0 30 16.0 31 25.0 32 25.5 33 33.0 34 52.0 35 70.0 36 96.0 37 120.5 38 144.0 39 160.5 40 181.0 41 224.5 42 242.0 43 260.0 44 279.0 45 273.0 46 267.5 47 257.0 48 241.0 49 201.0 50 156.5 51 139.0 52 116.5 53 92.5 54 78.0 55 58.5 56 35.5 57 21.5 58 21.5 59 19.5 60 13.0 61 9.5 62 6.5 63 5.0 64 4.5 65 2.0 66 3.0 67 2.0 68 1.0 69 2.0 70 1.5 71 0.5 72 1.0 73 1.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0375 48-49 0.125 50-51 0.13749999999999998 52-53 0.0625 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0625 76-77 0.125 78-79 0.025 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.075 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0125 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra Read 1868820 spots for SRR3207840.sra Written 1868820 spots for SRR3207840.sra Read 1868819 spots for SRR3207840.sra Written 1868819 spots for SRR3207840.sra SRR ids: ['SRR3207840.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kjgefyvc SRR3207840.sra spots: 37376381 blocks: [[1, 1868819], [1868820, 3737638], [3737639, 5606457], [5606458, 7475276], [7475277, 9344095], [9344096, 11212914], [11212915, 13081733], [13081734, 14950552], [14950553, 16819371], [16819372, 18688190], [18688191, 20557009], [20557010, 22425828], [22425829, 24294647], [24294648, 26163466], [26163467, 28032285], [28032286, 29901104], [29901105, 31769923], [31769924, 33638742], [33638743, 35507561], [35507562, 37376381]] SRR3207840 file size 9735666 SRR3207840 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207840 SRR3207840_1.fastq Input file: SRR3207840_1.fastq trimmed: SRR3207840-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 07:53:15 2025 >> started Tue Feb 11 07:53:35 2025 >> done (20.161s) 37376381 reads processed; of these: 3888 ( 0.01%) short reads filtered out after trimming by size control 13557 ( 0.04%) empty reads filtered out after trimming by size control 37358936 (99.95%) reads available; of these: 2707106 ( 7.25%) trimmed reads available after processing 34651830 (92.75%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 853 0.00% 19 1131 0.00% 20 1410 0.00% 21 1833 0.00% 22 2514 0.01% 23 3765 0.01% 24 4789 0.01% 25 6373 0.02% 26 6785 0.02% 27 6645 0.02% 28 6628 0.02% 29 7143 0.02% 30 7061 0.02% 31 7256 0.02% 32 7538 0.02% 33 7775 0.02% 34 8311 0.02% 35 8422 0.02% 36 9014 0.02% 37 9331 0.02% 38 9500 0.03% 39 10127 0.03% 40 10216 0.03% 41 10677 0.03% 42 10937 0.03% 43 11372 0.03% 44 11987 0.03% 45 12791 0.03% 46 12995 0.03% 47 13426 0.04% 48 13246 0.04% 49 12970 0.03% 50 12754 0.03% 51 13143 0.04% 52 13548 0.04% 53 14422 0.04% 54 15203 0.04% 55 15961 0.04% 56 16401 0.04% 57 17093 0.05% 58 17466 0.05% 59 17897 0.05% 60 18245 0.05% 61 18555 0.05% 62 19440 0.05% 63 19633 0.05% 64 19965 0.05% 65 21121 0.06% 66 21967 0.06% 67 23116 0.06% 68 23340 0.06% 69 24309 0.07% 70 25749 0.07% 71 27125 0.07% 72 27828 0.07% 73 29408 0.08% 74 30649 0.08% 75 32459 0.09% 76 17949 0.05% 77 20509 0.05% 78 25107 0.07% 79 28027 0.08% 80 30131 0.08% 81 32788 0.09% 82 34626 0.09% 83 37745 0.10% 84 38675 0.10% 85 41522 0.11% 86 44212 0.12% 87 48460 0.13% 88 52494 0.14% 89 57133 0.15% 90 65579 0.18% 91 73349 0.20% 92 84155 0.23% 93 97694 0.26% 94 114595 0.31% 95 137942 0.37% 96 165827 0.44% 97 192703 0.52% 98 228756 0.61% 99 245510 0.66% 100 34651830 92.75% 37358936 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=65.13 fanout-score-rank=8 prefix-density=0.31 prefix-fanout=32.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=287.72 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=27.9 sequence=TTCTTCTTCTTT Started job on | Feb 11 07:53:55 Started mapping on | Feb 11 07:53:56 Finished on | Feb 11 07:54:33 Mapping speed, Million of reads per hour | 3634.92 Number of input reads | 37358936 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 35775648 Uniquely mapped reads % | 95.76% Average mapped length | 98.28 Number of splices: Total | 10435434 Number of splices: Annotated (sjdb) | 10241236 Number of splices: GT/AG | 10272377 Number of splices: GC/AG | 133758 Number of splices: AT/AC | 10856 Number of splices: Non-canonical | 18443 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 1.93 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 870503 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 189854 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.39% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 712785 712785 712785 N_multimapping 870503 870503 870503 N_noFeature 1378577 18345308 18561145 N_ambiguous 365404 59238 58931 UnstrandedReadsAssigned:34031667 PositiveStrandReadsAssigned:17371102 NegativeStrandReadsAssigned:17155572 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207840 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207840-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,358,936 reads, 34,914,177 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,242 rounds 52401 SRR3207840.ke.tsv 34699 SRR3207840.se.tsv 87100 total ==> SRR3207840.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1361 29.4746 Potri.005G024800.1.v4.1 1035 936 261 11.5886 Potri.004G059700.1.v4.1 961 862 51 2.45883 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 792.219 11.5766 Potri.016G087400.1.v4.1 270 171 1590 386.426 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 162.519 4.03472 Potri.012G127500.1.v4.1 977 878 5306 251.153 ==> SRR3207840.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3096 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 669 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 37 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207840 completed mapping pipeline successfully