Starting /dee2/code/volunteer_pipeline.sh SRR3207841 current disk space = 3055727718400 free memory = 1485503848 SRR3207841 SRAfilesize bcfa768cb0fe7dc8172fcc4d0cfc992c SRR3207841.sra SRR3207841.sra file validated SRR3207841 is single end SRR3207841 is conventional basespace SRR3207841 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207841_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4325 34.0 31.0 34.0 31.0 34.0 2 32.6465 34.0 31.0 34.0 31.0 34.0 3 31.48425 34.0 31.0 34.0 27.0 34.0 4 35.84325 37.0 35.0 37.0 33.0 37.0 5 36.06 37.0 35.0 37.0 35.0 37.0 6 36.222 37.0 36.0 37.0 35.0 37.0 7 36.2005 37.0 37.0 37.0 35.0 37.0 8 36.23875 37.0 37.0 37.0 35.0 37.0 9 38.05375 39.0 38.0 39.0 37.0 39.0 10-11 38.042 39.0 38.0 39.0 35.0 39.0 12-13 37.962375 39.0 38.0 39.0 35.0 39.0 14-15 39.4765 41.0 39.0 41.0 36.0 41.0 16-17 39.496624999999995 41.0 39.0 41.0 36.5 41.0 18-19 39.327375 41.0 39.0 41.0 36.0 41.0 20-21 39.3115 41.0 39.0 41.0 36.0 41.0 22-23 39.286 41.0 39.0 41.0 36.0 41.0 24-25 39.331375 41.0 39.0 41.0 36.0 41.0 26-27 39.168 40.0 39.0 41.0 36.0 41.0 28-29 39.083749999999995 40.0 39.0 41.0 36.0 41.0 30-31 38.9625 40.0 38.5 41.0 35.0 41.0 32-33 38.724625 40.0 38.0 41.0 35.0 41.0 34-35 38.697 40.0 38.0 41.0 34.5 41.0 36-37 38.312875000000005 40.0 38.0 41.0 34.0 41.0 38-39 38.412000000000006 40.0 38.0 41.0 34.0 41.0 40-41 38.321 40.0 38.0 41.0 34.0 41.0 42-43 38.341499999999996 40.0 38.0 41.0 34.0 41.0 44-45 38.179500000000004 40.0 38.0 41.0 33.5 41.0 46-47 38.052 40.0 38.0 41.0 33.0 41.0 48-49 37.7285 40.0 37.0 41.0 33.0 41.0 50-51 37.651375 40.0 37.0 41.0 32.5 41.0 52-53 38.02175 40.0 38.0 41.0 33.0 41.0 54-55 38.172375 40.0 38.0 41.0 34.0 41.0 56-57 37.92525 40.0 37.5 41.0 33.5 41.0 58-59 37.7395 40.0 37.0 41.0 33.0 41.0 60-61 37.542249999999996 40.0 36.5 41.0 33.0 41.0 62-63 37.178625 39.0 36.0 41.0 32.0 41.0 64-65 36.91925 39.0 35.5 41.0 32.0 41.0 66-67 36.597624999999994 38.5 35.0 40.5 31.0 41.0 68-69 36.261250000000004 37.5 35.0 40.0 31.0 41.0 70-71 35.808875 37.0 35.0 39.5 31.0 41.0 72-73 35.189875 36.5 34.5 39.0 30.0 40.5 74-75 34.72225 36.0 34.0 38.5 29.0 40.0 76-77 33.200625 34.5 32.0 36.5 27.5 39.0 78-79 33.930499999999995 35.0 34.0 37.0 29.0 39.0 80-81 33.859 35.0 34.0 36.5 29.5 38.0 82-83 33.564375 35.0 34.0 36.0 29.5 37.0 84-85 33.24975 35.0 34.0 36.0 29.0 37.0 86-87 33.076875 35.0 34.0 35.0 29.0 36.0 88-89 32.797250000000005 35.0 34.0 35.0 29.0 36.0 90-91 32.449 35.0 33.0 35.0 28.5 36.0 92-93 32.28375 35.0 33.0 35.0 27.0 36.0 94-95 32.10825 35.0 33.0 35.0 27.0 35.0 96-97 31.834125 35.0 33.0 35.0 26.5 35.0 98-99 31.632875 35.0 33.0 35.0 25.5 35.0 100 31.451 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 1.0 10 1.0 11 5.0 12 4.0 13 4.0 14 3.0 15 2.0 16 9.0 17 9.0 18 7.0 19 10.0 20 7.0 21 7.0 22 11.0 23 5.0 24 11.0 25 16.0 26 15.0 27 26.0 28 33.0 29 42.0 30 61.0 31 65.0 32 96.0 33 133.0 34 154.0 35 232.0 36 419.0 37 919.0 38 1386.0 39 305.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.688285570638513 15.409753645047763 13.046757164404225 41.8552036199095 2 20.549999999999997 23.625 35.975 19.85 3 23.225 26.325 26.174999999999997 24.275 4 24.6 32.275 20.474999999999998 22.650000000000002 5 24.55 35.25 22.400000000000002 17.8 6 19.075 37.675 24.725 18.525 7 17.875 20.7 41.4 20.025000000000002 8 18.675 25.45 29.799999999999997 26.075 9 21.5 23.225 31.125000000000004 24.15 10-11 22.7 34.150000000000006 22.5 20.65 12-13 20.5875 27.8125 29.1875 22.412499999999998 14-15 21.075 28.449999999999996 28.299999999999997 22.175 16-17 22.625 28.3125 27.437499999999996 21.625 18-19 20.9875 28.749999999999996 27.962500000000002 22.3 20-21 23.3125 28.050000000000004 27.075 21.5625 22-23 21.725 28.6375 27.1625 22.475 24-25 21.575 28.575 27.187499999999996 22.662499999999998 26-27 21.8125 28.675 27.425 22.0875 28-29 21.3125 28.0875 27.775 22.825 30-31 21.3125 29.175 27.200000000000003 22.3125 32-33 22.75 28.037499999999998 27.962500000000002 21.25 34-35 21.15 28.1625 28.0875 22.6 36-37 22.175 28.075 27.3875 22.3625 38-39 21.8625 28.375 28.125 21.637500000000003 40-41 22.287499999999998 27.800000000000004 27.500000000000004 22.412499999999998 42-43 21.0625 29.1875 27.462500000000002 22.287499999999998 44-45 22.537499999999998 28.225 27.55 21.6875 46-47 22.037499999999998 28.275 27.787499999999998 21.9 48-49 22.158309366012254 27.210203826434913 28.073027385269476 22.558459422283356 50-51 22.095785919719894 27.860447667875455 28.48568213079905 21.558084281605602 52-53 22.46530816352044 28.391048881110137 28.091011376422053 21.052631578947366 54-55 22.45 28.512500000000003 26.400000000000002 22.6375 56-57 22.675 28.237499999999997 27.224999999999998 21.8625 58-59 22.1875 28.7 27.187499999999996 21.925 60-61 22.725 28.050000000000004 26.437500000000004 22.787499999999998 62-63 21.8875 28.1375 28.1375 21.837500000000002 64-65 22.3625 28.499999999999996 27.9375 21.2 66-67 22.287499999999998 27.55 27.775 22.3875 68-69 21.6875 27.6125 29.15 21.55 70-71 21.1875 27.975 28.4125 22.425 72-73 22.5875 27.987499999999997 27.85 21.575 74-75 21.965245655706962 27.91598949868734 27.953494186773348 22.165270658832352 76-77 21.21780445111278 28.257064266066518 27.819454863715933 22.705676419104776 78-79 21.8 28.9375 28.0875 21.175 80-81 22.162499999999998 27.825 28.1625 21.85 82-83 22.025 28.799999999999997 27.3 21.875 84-85 21.212500000000002 28.1625 28.212500000000002 22.412499999999998 86-87 22.0 28.037499999999998 28.0875 21.875 88-89 21.9 27.8875 29.2375 20.974999999999998 90-91 21.825 27.875 28.512500000000003 21.7875 92-93 22.05 28.050000000000004 28.4125 21.4875 94-95 21.9625 27.975 28.212500000000002 21.85 96-97 22.8125 28.012500000000003 28.012500000000003 21.1625 98-99 21.477684710588825 27.57844730591324 29.22865358169771 21.715214401800225 100 22.725 28.325 27.55 21.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 3.0 27 5.5 28 8.0 29 12.0 30 13.0 31 19.0 32 31.0 33 40.0 34 52.0 35 73.0 36 95.5 37 115.0 38 140.0 39 168.0 40 211.5 41 238.5 42 254.5 43 278.0 44 256.5 45 258.5 46 272.5 47 249.5 48 230.5 49 201.5 50 161.0 51 128.5 52 102.0 53 85.0 54 70.0 55 49.5 56 39.5 57 33.5 58 23.5 59 18.5 60 12.0 61 2.5 62 3.5 63 4.0 64 5.0 65 7.5 66 5.5 67 4.0 68 3.5 69 1.5 70 1.5 71 2.0 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 1.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0375 50-51 0.0375 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725389 spots for SRR3207841.sra Written 725389 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra Read 725387 spots for SRR3207841.sra Written 725387 spots for SRR3207841.sra SRR ids: ['SRR3207841.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4br84bkf SRR3207841.sra spots: 14507742 blocks: [[1, 725387], [725388, 1450774], [1450775, 2176161], [2176162, 2901548], [2901549, 3626935], [3626936, 4352322], [4352323, 5077709], [5077710, 5803096], [5803097, 6528483], [6528484, 7253870], [7253871, 7979257], [7979258, 8704644], [8704645, 9430031], [9430032, 10155418], [10155419, 10880805], [10880806, 11606192], [11606193, 12331579], [12331580, 13056966], [13056967, 13782353], [13782354, 14507742]] SRR3207841 file size 3772231 SRR3207841 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207841 SRR3207841_1.fastq Input file: SRR3207841_1.fastq trimmed: SRR3207841-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Feb 11 08:23:53 2025 >> started Tue Feb 11 08:24:00 2025 >> done (6.476s) 14507742 reads processed; of these: 1418 ( 0.01%) short reads filtered out after trimming by size control 3932 ( 0.03%) empty reads filtered out after trimming by size control 14502392 (99.96%) reads available; of these: 997534 ( 6.88%) trimmed reads available after processing 13504858 (93.12%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 302 0.00% 19 471 0.00% 20 586 0.00% 21 730 0.01% 22 1026 0.01% 23 1667 0.01% 24 2100 0.01% 25 2636 0.02% 26 2752 0.02% 27 2702 0.02% 28 2787 0.02% 29 2936 0.02% 30 2921 0.02% 31 2921 0.02% 32 3168 0.02% 33 3125 0.02% 34 3376 0.02% 35 3364 0.02% 36 3644 0.03% 37 3693 0.03% 38 3759 0.03% 39 4053 0.03% 40 4006 0.03% 41 4276 0.03% 42 4287 0.03% 43 4616 0.03% 44 4726 0.03% 45 5021 0.03% 46 5015 0.03% 47 5204 0.04% 48 5045 0.03% 49 4980 0.03% 50 4892 0.03% 51 4956 0.03% 52 5211 0.04% 53 5284 0.04% 54 5740 0.04% 55 5972 0.04% 56 5962 0.04% 57 6098 0.04% 58 6370 0.04% 59 6638 0.05% 60 6739 0.05% 61 6728 0.05% 62 6904 0.05% 63 7281 0.05% 64 7244 0.05% 65 7495 0.05% 66 8068 0.06% 67 8288 0.06% 68 8375 0.06% 69 8877 0.06% 70 9310 0.06% 71 9795 0.07% 72 10098 0.07% 73 10455 0.07% 74 11188 0.08% 75 11583 0.08% 76 6384 0.04% 77 7557 0.05% 78 9086 0.06% 79 9933 0.07% 80 10747 0.07% 81 11752 0.08% 82 12295 0.08% 83 13546 0.09% 84 14107 0.10% 85 14979 0.10% 86 16189 0.11% 87 17634 0.12% 88 18846 0.13% 89 20665 0.14% 90 23574 0.16% 91 26464 0.18% 92 30526 0.21% 93 35381 0.24% 94 41476 0.29% 95 50400 0.35% 96 60817 0.42% 97 70953 0.49% 98 84671 0.58% 99 92106 0.64% 100 13504858 93.12% 14502392 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=22.29 fanout-score-rank=9 prefix-density=0.10 prefix-fanout=15.0 sequence=AGATCGGAAGAGCACACGTCTGAACT criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=312.58 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=29.1 sequence=TTCTTCTTCTTT Started job on | Feb 11 08:24:18 Started mapping on | Feb 11 08:24:18 Finished on | Feb 11 08:24:35 Mapping speed, Million of reads per hour | 3071.09 Number of input reads | 14502392 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 13843745 Uniquely mapped reads % | 95.46% Average mapped length | 98.26 Number of splices: Total | 4030436 Number of splices: Annotated (sjdb) | 3954324 Number of splices: GT/AG | 3966187 Number of splices: GC/AG | 52427 Number of splices: AT/AC | 4203 Number of splices: Non-canonical | 7619 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 1.88 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343266 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 78918 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.62% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 315381 315381 315381 N_multimapping 343266 343266 343266 N_noFeature 553276 7124778 7180273 N_ambiguous 137309 22678 22872 UnstrandedReadsAssigned:13153160 PositiveStrandReadsAssigned:6696289 NegativeStrandReadsAssigned:6640600 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207841 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207841-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,502,392 reads, 13,519,706 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR3207841.ke.tsv 34699 SRR3207841.se.tsv 87100 total ==> SRR3207841.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 579 31.8003 Potri.005G024800.1.v4.1 1035 936 156 17.5662 Potri.004G059700.1.v4.1 961 862 9 1.10043 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 313.359 11.6129 Potri.016G087400.1.v4.1 270 171 634 390.77 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 66.5364 4.18921 Potri.012G127500.1.v4.1 977 878 2311 277.417 ==> SRR3207841.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1064 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207841 completed mapping pipeline successfully